DC900116

Overview
NameDC900116
Unique NameDC900116
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length1107
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig3510 contig Csv1_Contig3510:263..1369. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Homology
BLAST of DC900116 vs. ExPASy Swiss-Prot
Match: PCKA_OCEIH (Phosphoenolpyruvate carboxykinase [ATP] OS=Oceanobacillus iheyensis GN=pckA PE=3 SV=1)

HSP 1 Score: 309.301 bits (791), Expect = 2.603e-83
Identity = 151/291 (51.89%), Postives = 193/291 (66.32%), Query Frame = 2
Query:    2 KDGXVAXXXXXXXXXXXXXXXDHNRYLIGDDEHCWGDNGVSNIEGGCYAKCIDLSREKEPDIWNAIKFGAVLENVVFDEHTREVDYSDKSVTENTRAAYPIEYIPNAKIPCVGPHPKNVILLACDAFGVLPPVSKLNLAQTMYHFISGYTALVAGTEDGIKEPTATFSACFGAAFIMLHPTKYAAMLAEKMQKHGATGWLVNTGWSGGSYGCGSRIKLPYTRKIIDAIHSGSLLNANYKKTDVFGVEIPTEVEGVPSEILDPENTWADKQAYKETLLKLAGLFKRNFEIFT 874
            ++G VA               D  R LIGDDEH W  NGV NIEGGCYAKCI+LS EKEP I+NAI++G VLENV+ ++++RE DY D S+TENTRAAYP+E I N   P V  HP  +I L  DA G LPP+SKL   Q MYHF+SGYT+ +AGTE G+ EP ATFSACFG+ F+ L P+KYA ML +K+       +L+NTGW+GGSYG G RIKL +TR ++ +   G L +      ++FG++IP  V GVP E+L P+ TW +K+AY +    LA  F  NF+ FT
Sbjct:  222 QEGDVALFFGLSGTGKTTLSADPYRKLIGDDEHGWSPNGVFNIEGGCYAKCINLSEEKEPQIYNAIRYGTVLENVILNDNSREPDYDDTSLTENTRAAYPLENIDNIINPSVAGHPNTIIFLTADASGTLPPISKLTKEQAMYHFLSGYTSKLAGTERGVTEPLATFSACFGSPFLPLAPSKYAEMLGKKIDMFDTNVFLINTGWTGGSYGVGDRIKLSFTRAMVHSALEGELNSIETITDEIFGLQIPAHVPGVPDELLVPKQTWGNKEAYMKEAQTLALKFHENFKKFT 512          
BLAST of DC900116 vs. ExPASy Swiss-Prot
Match: PCKA_ALKOO (Phosphoenolpyruvate carboxykinase [ATP] OS=Alkaliphilus oremlandii (strain OhILAs) GN=pckA PE=3 SV=1)

HSP 1 Score: 309.301 bits (791), Expect = 2.603e-83
Identity = 151/290 (52.07%), Postives = 189/290 (65.17%), Query Frame = 2
Query:    2 KDGXVAXXXXXXXXXXXXXXXDHNRYLIGDDEHCWGDNGVSNIEGGCYAKCIDLSREKEPDIWNAIKFGAVLENVVFDEHTREVDYSDKSVTENTRAAYPIEYIPNAKIPCVGPHPKNVILLACDAFGVLPPVSKLNLAQTMYHFISGYTALVAGTEDGIKEPTATFSACFGAAFIMLHPTKYAAMLAEKMQKHGATGWLVNTGWSGGSYGCGSRIKLPYTRKIIDAIHSGSLLNANYKKTDVFGVEIPTEVEGVPSEILDPENTWADKQAYKETLLKLAGLFKRNFEIF 871
            +DG VA               D+NR LIGDDEH W  NGV N EGGCYAKCI+L+ E+EP IWNAIK GA+LEN+V DE+T  +DY D   TENTRAAYP+EYI +A +   G  P  +I L  DA GVLPP++KL   Q MYHF+SGYT+ +AGTE GI EPTATFS CFG  F++L P  YA +L EK++K+    +LVNTGW+GG YG GSR+KL YTR ++ A   G L    Y K  +F + IPT    VP E+L+P  TW ++  Y +   +LA  F  NF+ F
Sbjct:  222 EDGNVALFFGLSGTGKTTLSADNNRKLIGDDEHGWTANGVFNFEGGCYAKCINLTEEQEPQIWNAIKHGAILENIVIDENTGHIDYDDDRYTENTRAAYPVEYIDDAVLEGKGGIPNTIIFLTADATGVLPPIAKLTKEQAMYHFMSGYTSKLAGTERGIVEPTATFSTCFGGPFMLLKPQTYAKLLGEKIEKYNTRVFLVNTGWTGGPYGIGSRMKLKYTRSMVRAAIKGELDQVEYIKDPIFNLSIPTTCPEVPVEVLEPSKTWDNQDEYDQKANELAKSFVENFKKF 511          
BLAST of DC900116 vs. ExPASy Swiss-Prot
Match: PCKA_SILPO (Phosphoenolpyruvate carboxykinase [ATP] OS=Silicibacter pomeroyi GN=pckA PE=3 SV=1)

HSP 1 Score: 308.916 bits (790), Expect = 3.400e-83
Identity = 144/273 (52.75%), Postives = 188/273 (68.86%), Query Frame = 2
Query:   65 DHNRYLIGDDEHCWGDNGVSNIEGGCYAKCIDLSREKEPDIW-NAIKFGAVLENVVFDEHTREVDYSDKSVTENTRAAYPIEYIPNAKIPCVGPHPKNVILLACDAFGVLPPVSKLNLAQTMYHFISGYTALVAGTEDGIKEPTATFSACFGAAFIMLHPTKYAAMLAEKMQKHGATGWLVNTGWSGGSYGCGSRIKLPYTRKIIDAIHSGSLLNANYKKTDVFGVEIPTEVEGVPSEILDPENTWADKQAYKETLLKLAGLFKRNFEIFTNY 880
            D  R LIGDDEH W D G  N EGGCYAK I+L+ E EP+I+    KF  V+EN+VFDE T+E+D+ D S+T N R AYP+EYI NA +  +G HPKN+I+L CDAFGVLPP+++L  AQ MYHF+SG+T+ VAGTE G+ EP  TFS CFGA F+   P  Y  +L +K+ +HGAT WLVNTGW+GG+YG GSR+ +  TR ++ A  +GSL NA ++K   FG ++P  V GV   +LDP  TW D+ A+ +   KL  +F  NFE +  Y
Sbjct:  249 DPARVLIGDDEHGWSDRGTFNFEGGCYAKTINLNPEAEPEIYATTTKFATVIENMVFDEETKELDFDDDSLTANMRCAYPLEYISNASVSALGGHPKNIIMLTCDAFGVLPPIARLTPAQAMYHFLSGFTSKVAGTERGVTEPQPTFSTCFGAPFMPRRPEVYGNLLRDKIARHGATCWLVNTGWTGGAYGVGSRMPIKATRALLTAALNGSLNNAEFRKDGNFGFDVPVSVPGVAEVLLDPRRTWDDQGAFDKQAAKLVQMFADNFEQYVPY 521          
BLAST of DC900116 vs. ExPASy Swiss-Prot
Match: PCKA_BACSK (Phosphoenolpyruvate carboxykinase [ATP] OS=Bacillus clausii (strain KSM-K16) GN=pckA PE=3 SV=1)

HSP 1 Score: 308.531 bits (789), Expect = 4.440e-83
Identity = 148/267 (55.43%), Postives = 183/267 (68.54%), Query Frame = 2
Query:   71 NRYLIGDDEHCWGDNGVSNIEGGCYAKCIDLSREKEPDIWNAIKFGAVLENVVFDEHTREVDYSDKSVTENTRAAYPIEYIPNAKIPCVGPHPKNVILLACDAFGVLPPVSKLNLAQTMYHFISGYTALVAGTEDGIKEPTATFSACFGAAFIMLHPTKYAAMLAEKMQKHGATGWLVNTGWSGGSYGCGSRIKLPYTRKIIDAIHSGSLLNANYKKTDVFGVEIPTEVEGVPSEILDPENTWADKQAYKETLLKLAGLFKRNFEIF 871
            +R LIGDDEH W + G+ NIEGGCYAKCI LS+E EP IW+AI FGAVLENVV D +T + D+    +TENTRAAYP+E IPNA +P V   PK +I L  DAFGVLPP+SKL   Q MYHF+SGYT+ +AGTE GI +P ATFS CFGA F+   P +YA ML +K++      +LVNTGW+GGSYG G+RIKL YTR +++A   G L         +FG+ +PT   GVP E+L P   W D+ AY+ T L+LA  F  NF  F
Sbjct:  246 HRRLIGDDEHGWSEKGIFNIEGGCYAKCIGLSKESEPQIWDAIAFGAVLENVVVDPNTGKPDFKSGELTENTRAAYPLEAIPNALLPSVAGPPKAIIFLTADAFGVLPPISKLTKEQAMYHFLSGYTSKLAGTERGITQPEATFSTCFGAPFLPRKPEEYATMLGDKLENDDVQVFLVNTGWTGGSYGTGTRIKLAYTRAMVEAALQGKLDEIETVCDPIFGLYVPTHCPGVPDELLTPRRVWKDEAAYEATALQLAKQFHENFSAF 512          
BLAST of DC900116 vs. ExPASy Swiss-Prot
Match: PCKA_CAMJJ (Phosphoenolpyruvate carboxykinase [ATP] OS=Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176) GN=pckA PE=3 SV=1)

HSP 1 Score: 307.76 bits (787), Expect = 7.574e-83
Identity = 155/275 (56.36%), Postives = 191/275 (69.45%), Query Frame = 2
Query:   65 DHNRYLIGDDEHCWGDNGVSNIEGGCYAKCIDLSREKEPDIWNAIKFGAVLENVVFDEHTREVDYSDKSVTENTRAAYPIEYIPNAKIPCVGPHPKNVILLACDAFGVLPPVSKLNLAQTMYHFISGYTALVAGTEDGIKEPTATFSACFGAAFIMLHPTKYAAMLAEKMQKHGATGWLVNTGWSGGSYGCGSRIKLPYTRKIIDAIHSGSLLNANYKKTDVFGVEIPTEVEGVPSEILDPENTWADKQAYKETLLKLAGLFKRNFEIFTNYKIG 889
            D  R LIGDDEH W D GV N EGGCYAK I+L  E EP+I+ AIK  A+LENVV     + VDY+D S TENTR +YPIE+I N +      HPKN+I L+ DAFG+LPPVSKL+  Q MY+F+SGYTA VAGTE GI EP ATFSACFG  F+ LHPT YA +L EK++KH    +LVNTGWSGGSYG G R+ +  TR  I+AI  GS+    ++  +VF + IP  +EGV S +L+P NTW DK AY ET  KLA +F +NF+ + + K G
Sbjct:  241 DPKRRLIGDDEHGWDDEGVFNFEGGCYAKTINLDPEHEPEIYGAIKRNALLENVVL-RADKSVDYADASKTENTRVSYPIEHIENHEPSLKAGHPKNIIFLSADAFGILPPVSKLSKEQAMYYFLSGYTAKVAGTERGITEPQATFSACFGEPFMPLHPTVYARLLGEKIEKHEVNVYLVNTGWSGGSYGVGKRMSIKATRACINAILDGSIAKCEFENFEVFNLAIPKALEGVESTLLNPINTWLDKNAYAETRDKLAHMFVQNFKRYEDVKEG 514          
BLAST of DC900116 vs. ExPASy Swiss-Prot
Match: PCKA_CAMJ8 (Phosphoenolpyruvate carboxykinase [ATP] OS=Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828) GN=pckA PE=3 SV=1)

HSP 1 Score: 307.76 bits (787), Expect = 7.574e-83
Identity = 155/275 (56.36%), Postives = 191/275 (69.45%), Query Frame = 2
Query:   65 DHNRYLIGDDEHCWGDNGVSNIEGGCYAKCIDLSREKEPDIWNAIKFGAVLENVVFDEHTREVDYSDKSVTENTRAAYPIEYIPNAKIPCVGPHPKNVILLACDAFGVLPPVSKLNLAQTMYHFISGYTALVAGTEDGIKEPTATFSACFGAAFIMLHPTKYAAMLAEKMQKHGATGWLVNTGWSGGSYGCGSRIKLPYTRKIIDAIHSGSLLNANYKKTDVFGVEIPTEVEGVPSEILDPENTWADKQAYKETLLKLAGLFKRNFEIFTNYKIG 889
            D  R LIGDDEH W D GV N EGGCYAK I+L  E EP+I+ AIK  A+LENVV     + VDY+D S TENTR +YPIE+I N +      HPKN+I L+ DAFG+LPPVSKL+  Q MY+F+SGYTA VAGTE GI EP ATFSACFG  F+ LHPT YA +L EK++KH    +LVNTGWSGGSYG G R+ +  TR  I+AI  GS+    ++  +VF + IP  +EGV S +L+P NTW DK AY ET  KLA +F +NF+ + + K G
Sbjct:  241 DPKRRLIGDDEHGWDDEGVFNFEGGCYAKTINLDPEHEPEIYGAIKRNALLENVVL-RADKSVDYADASKTENTRVSYPIEHIENHEPSLKAGHPKNIIFLSADAFGILPPVSKLSKEQAMYYFLSGYTAKVAGTERGITEPQATFSACFGEPFMPLHPTVYARLLGEKIEKHEVNVYLVNTGWSGGSYGVGKRMSIKATRACINAILDGSIAKCEFENFEVFNLAIPKALEGVESTLLNPINTWLDKNAYTETRDKLAHMFVQNFKRYEDVKEG 514          
BLAST of DC900116 vs. ExPASy Swiss-Prot
Match: PCKA_STAAU (Phosphoenolpyruvate carboxykinase [ATP] OS=Staphylococcus aureus GN=pckA PE=3 SV=1)

HSP 1 Score: 307.375 bits (786), Expect = 9.892e-83
Identity = 149/269 (55.39%), Postives = 183/269 (68.03%), Query Frame = 2
Query:   65 DHNRYLIGDDEHCWGDNGVSNIEGGCYAKCIDLSREKEPDIWNAIKFGAVLENVVFDEHTREVDYSDKSVTENTRAAYPIEYIPNAKIPCVGPHPKNVILLACDAFGVLPPVSKLNLAQTMYHFISGYTALVAGTEDGIKEPTATFSACFGAAFIMLHPTKYAAMLAEKMQKHGATGWLVNTGWSGGSYGCGSRIKLPYTRKIIDAIHSGSLLNANYKKTDVFGVEIPTEVEGVPSEILDPENTWADKQAYKETLLKLAGLFKRNFEIF 871
            D +R LIGDDEH W  NGV NIEGGCYAK I+LS+EKEP I++AIK+GA+LEN V  E    VD+ D   TENTRAAYPI +I N  +P    HP  +I L  DAFGV+PP+SKLN  Q MYHF+SG+T+ +AGTE G+ EP  +FS CFGA F  LHPT YA +L E +  H    +LVNTGW+GG YG G RI L YTR++++   SG L NA Y K   FG+ IP E+E VP  IL+P N W+DK+ YK     L   F++NFE F
Sbjct:  248 DPHRKLIGDDEHGWNKNGVFNIEGGCYAKAINLSKEKEPQIFDAIKYGAILENTVVAEDG-SVDFEDNRYTENTRAAYPINHIDNIVVPSKAAHPNTIIFLTADAFGVIPPISKLNKDQAMYHFLSGFTSKLAGTERGVTEPEPSFSTCFGAPFFPLHPTVYADLLGELIDLHDVDVYLVNTGWTGGKYGVGRRISLHYTRQMVNQAISGKLKNAEYTKDSTFGLSIPVEIEDVPKTILNPINAWSDKEKYKAQAEDLIQRFEKNFEKF 515          
BLAST of DC900116 vs. ExPASy Swiss-Prot
Match: PCKA_STAAT (Phosphoenolpyruvate carboxykinase [ATP] OS=Staphylococcus aureus (strain USA300 / TCH1516) GN=pckA PE=3 SV=1)

HSP 1 Score: 307.375 bits (786), Expect = 9.892e-83
Identity = 149/269 (55.39%), Postives = 183/269 (68.03%), Query Frame = 2
Query:   65 DHNRYLIGDDEHCWGDNGVSNIEGGCYAKCIDLSREKEPDIWNAIKFGAVLENVVFDEHTREVDYSDKSVTENTRAAYPIEYIPNAKIPCVGPHPKNVILLACDAFGVLPPVSKLNLAQTMYHFISGYTALVAGTEDGIKEPTATFSACFGAAFIMLHPTKYAAMLAEKMQKHGATGWLVNTGWSGGSYGCGSRIKLPYTRKIIDAIHSGSLLNANYKKTDVFGVEIPTEVEGVPSEILDPENTWADKQAYKETLLKLAGLFKRNFEIF 871
            D +R LIGDDEH W  NGV NIEGGCYAK I+LS+EKEP I++AIK+GA+LEN V  E    VD+ D   TENTRAAYPI +I N  +P    HP  +I L  DAFGV+PP+SKLN  Q MYHF+SG+T+ +AGTE G+ EP  +FS CFGA F  LHPT YA +L E +  H    +LVNTGW+GG YG G RI L YTR++++   SG L NA Y K   FG+ IP E+E VP  IL+P N W+DK+ YK     L   F++NFE F
Sbjct:  248 DPHRKLIGDDEHGWNKNGVFNIEGGCYAKAINLSKEKEPQIFDAIKYGAILENTVVAEDG-SVDFEDNRYTENTRAAYPINHIDNIVVPSKAAHPNTIIFLTADAFGVIPPISKLNKDQAMYHFLSGFTSKLAGTERGVTEPEPSFSTCFGAPFFPLHPTVYADLLGELIDLHDVDVYLVNTGWTGGKYGVGRRISLHYTRQMVNQAISGKLKNAEYTKDSTFGLSIPVEIEDVPKTILNPINAWSDKEKYKAQAEDLIQRFEKNFEKF 515          
BLAST of DC900116 vs. ExPASy Swiss-Prot
Match: PCKA_STAAR (Phosphoenolpyruvate carboxykinase [ATP] OS=Staphylococcus aureus (strain MRSA252) GN=pckA PE=3 SV=1)

HSP 1 Score: 307.375 bits (786), Expect = 9.892e-83
Identity = 149/269 (55.39%), Postives = 183/269 (68.03%), Query Frame = 2
Query:   65 DHNRYLIGDDEHCWGDNGVSNIEGGCYAKCIDLSREKEPDIWNAIKFGAVLENVVFDEHTREVDYSDKSVTENTRAAYPIEYIPNAKIPCVGPHPKNVILLACDAFGVLPPVSKLNLAQTMYHFISGYTALVAGTEDGIKEPTATFSACFGAAFIMLHPTKYAAMLAEKMQKHGATGWLVNTGWSGGSYGCGSRIKLPYTRKIIDAIHSGSLLNANYKKTDVFGVEIPTEVEGVPSEILDPENTWADKQAYKETLLKLAGLFKRNFEIF 871
            D +R LIGDDEH W  NGV NIEGGCYAK I+LS+EKEP I++AIK+GA+LEN V  E    VD+ D   TENTRAAYPI +I N  +P    HP  +I L  DAFGV+PP+SKLN  Q MYHF+SG+T+ +AGTE G+ EP  +FS CFGA F  LHPT YA +L E +  H    +LVNTGW+GG YG G RI L YTR++++   SG L NA Y K   FG+ IP E+E VP  IL+P N W+DK+ YK     L   F++NFE F
Sbjct:  248 DPHRKLIGDDEHGWNKNGVFNIEGGCYAKAINLSKEKEPQIFDAIKYGAILENTVVAEDG-SVDFEDNRYTENTRAAYPINHIDNIVVPSKAAHPNTIIFLTADAFGVIPPISKLNKDQAMYHFLSGFTSKLAGTERGVTEPEPSFSTCFGAPFFPLHPTVYADLLGELIDLHDVDVYLVNTGWTGGKYGVGRRISLHYTRQMVNQAISGKLKNAEYTKDSTFGLSIPVEIEDVPKTILNPINAWSDKEKYKTQAEDLIQRFEKNFEKF 515          
BLAST of DC900116 vs. ExPASy Swiss-Prot
Match: PCKA_STAAN (Phosphoenolpyruvate carboxykinase [ATP] OS=Staphylococcus aureus (strain N315) GN=pckA PE=1 SV=1)

HSP 1 Score: 307.375 bits (786), Expect = 9.892e-83
Identity = 149/269 (55.39%), Postives = 183/269 (68.03%), Query Frame = 2
Query:   65 DHNRYLIGDDEHCWGDNGVSNIEGGCYAKCIDLSREKEPDIWNAIKFGAVLENVVFDEHTREVDYSDKSVTENTRAAYPIEYIPNAKIPCVGPHPKNVILLACDAFGVLPPVSKLNLAQTMYHFISGYTALVAGTEDGIKEPTATFSACFGAAFIMLHPTKYAAMLAEKMQKHGATGWLVNTGWSGGSYGCGSRIKLPYTRKIIDAIHSGSLLNANYKKTDVFGVEIPTEVEGVPSEILDPENTWADKQAYKETLLKLAGLFKRNFEIF 871
            D +R LIGDDEH W  NGV NIEGGCYAK I+LS+EKEP I++AIK+GA+LEN V  E    VD+ D   TENTRAAYPI +I N  +P    HP  +I L  DAFGV+PP+SKLN  Q MYHF+SG+T+ +AGTE G+ EP  +FS CFGA F  LHPT YA +L E +  H    +LVNTGW+GG YG G RI L YTR++++   SG L NA Y K   FG+ IP E+E VP  IL+P N W+DK+ YK     L   F++NFE F
Sbjct:  248 DPHRKLIGDDEHGWNKNGVFNIEGGCYAKAINLSKEKEPQIFDAIKYGAILENTVVAEDG-SVDFEDNRYTENTRAAYPINHIDNIVVPSKAAHPNTIIFLTADAFGVIPPISKLNKDQAMYHFLSGFTSKLAGTERGVTEPEPSFSTCFGAPFFPLHPTVYADLLGELIDLHDVDVYLVNTGWTGGKYGVGRRISLHYTRQMVNQAISGKLKNAEYTKDSTFGLSIPVEIEDVPKTILNPINAWSDKEKYKAQAEDLIQRFEKNFEKF 515          
The following BLAST results are available for this feature:
BLAST of DC900116 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 284
Match NameE-valueIdentityDescription
PCKA_OCEIH2.603e-8351.89Phosphoenolpyruvate carboxykinase [ATP] OS=Oceanob... [more]
PCKA_ALKOO2.603e-8352.07Phosphoenolpyruvate carboxykinase [ATP] OS=Alkalip... [more]
PCKA_SILPO3.400e-8352.75Phosphoenolpyruvate carboxykinase [ATP] OS=Silicib... [more]
PCKA_BACSK4.440e-8355.43Phosphoenolpyruvate carboxykinase [ATP] OS=Bacillu... [more]
PCKA_CAMJJ7.574e-8356.36Phosphoenolpyruvate carboxykinase [ATP] OS=Campylo... [more]
PCKA_CAMJ87.574e-8356.36Phosphoenolpyruvate carboxykinase [ATP] OS=Campylo... [more]
PCKA_STAAU9.892e-8355.39Phosphoenolpyruvate carboxykinase [ATP] OS=Staphyl... [more]
PCKA_STAAT9.892e-8355.39Phosphoenolpyruvate carboxykinase [ATP] OS=Staphyl... [more]
PCKA_STAAR9.892e-8355.39Phosphoenolpyruvate carboxykinase [ATP] OS=Staphyl... [more]
PCKA_STAAN9.892e-8355.39Phosphoenolpyruvate carboxykinase [ATP] OS=Staphyl... [more]

Pages

back to top
Properties
Property NameValue
Genbank descriptionDC900116 VSS Citrus sinensis cDNA clone VS27V30 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900116 ID=DC900116|Name=DC900116|organism=Citrus sinensis|type=EST|length=1107bp
AAAAGATGGCNATGTTGCCCTCTTCTTTGGATTGTCAGGTACTGGAAAGA
CAACACTGTCTACTGATCACAATCGATATCTGATTGGAGACGATGAACAC
TGTTGGGGTGACAATGGTGTGTCAAACATTGAGGGTGGTTGCTATGCCAA
GTGCATTGATCTCTCAAGGGAGAAGGAGCCTGATATCTGGAATGCCATCA
AGTTTGGCGCTGTGTTGGAAAATGTTGTGTTTGATGAGCATACCAGAGAG
GTGGATTATTCTGACAAATCTGTCACAGAGAACACTCGTGCTGCCTACCC
CATTGAGTATATCCCCAATGCAAAGATACCATGCGTTGGTCCTCATCCCA
AGAATGTCATCCTTTTGGCATGTGATGCTTTTGGTGTACTCCCACCAGTG
AGCAAGCTGAACCTGGCACAAACAATGTACCATTTCATCAGTGGCTACAC
TGCTTTGGTAGCTGGAACAGAGGATGGTATTAAGGAGCCAACGGCAACAT
TTTCAGCTTGCTTTGGTGCAGCATTTATCATGCTGCATCCTACCAAGTAT
GCAGCAATGCTGGCTGAGAAGATGCAGAAGCATGGTGCTACAGGATGGCT
CGTCAACACTGGATGGTCAGGTGGAAGCTATGGTTGTGGCAGCCGCATCA
AGTTACCGTACACTCGAAAAATCATTGATGCGATACACTCTGGCAGCCTG
TTGAATGCAAATTACAAGAAAACTGATGTATTTGGGGTGGAAATCCCCAC
TGAAGTCGAGGGAGTGCCTTCAGAAATCCTGGATCCAGAGAACACTTGGG
CAGACAAGCAGGCTTACAAGGAGACACTGCTGAAGCTGGCTGGTCTTTTC
AAGAGGAACTTTGAAATATTCACAAACTACAAGATTGGCAAGGACAACAA
GCTCACTGAAGAGATCCTTGNANCTGGTCCAAATTTCTAATTTAGACCGA
GTGAAGAACAAGCAAAGAACGTGAGTGTGGTTTGGGAAATATGATGGAAA
TAAAGCGTAATATAGTCATATTCGACATGTGTGGTTCGATTCATATGTAA
ACTTGTTCTCCTGNATTAATTAAGTAATCCAAAAATTTGAGTCANCGATT
TTAATTA
back to top