DC900116

Overview
NameDC900116
Unique NameDC900116
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length1107
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig3510 contig Csv1_Contig3510:263..1369. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Homology
BLAST of DC900116 vs. ExPASy Swiss-Prot
Match: PCKA_STAAM (Phosphoenolpyruvate carboxykinase [ATP] OS=Staphylococcus aureus (strain Mu50 / ATCC 700699) GN=pckA PE=1 SV=1)

HSP 1 Score: 307.375 bits (786), Expect = 9.892e-83
Identity = 149/269 (55.39%), Postives = 183/269 (68.03%), Query Frame = 2
Query:   65 DHNRYLIGDDEHCWGDNGVSNIEGGCYAKCIDLSREKEPDIWNAIKFGAVLENVVFDEHTREVDYSDKSVTENTRAAYPIEYIPNAKIPCVGPHPKNVILLACDAFGVLPPVSKLNLAQTMYHFISGYTALVAGTEDGIKEPTATFSACFGAAFIMLHPTKYAAMLAEKMQKHGATGWLVNTGWSGGSYGCGSRIKLPYTRKIIDAIHSGSLLNANYKKTDVFGVEIPTEVEGVPSEILDPENTWADKQAYKETLLKLAGLFKRNFEIF 871
            D +R LIGDDEH W  NGV NIEGGCYAK I+LS+EKEP I++AIK+GA+LEN V  E    VD+ D   TENTRAAYPI +I N  +P    HP  +I L  DAFGV+PP+SKLN  Q MYHF+SG+T+ +AGTE G+ EP  +FS CFGA F  LHPT YA +L E +  H    +LVNTGW+GG YG G RI L YTR++++   SG L NA Y K   FG+ IP E+E VP  IL+P N W+DK+ YK     L   F++NFE F
Sbjct:  248 DPHRKLIGDDEHGWNKNGVFNIEGGCYAKAINLSKEKEPQIFDAIKYGAILENTVVAEDG-SVDFEDNRYTENTRAAYPINHIDNIVVPSKAAHPNTIIFLTADAFGVIPPISKLNKDQAMYHFLSGFTSKLAGTERGVTEPEPSFSTCFGAPFFPLHPTVYADLLGELIDLHDVDVYLVNTGWTGGKYGVGRRISLHYTRQMVNQAISGKLKNAEYTKDSTFGLSIPVEIEDVPKTILNPINAWSDKEKYKAQAEDLIQRFEKNFEKF 515          
BLAST of DC900116 vs. ExPASy Swiss-Prot
Match: PCKA_STAAE (Phosphoenolpyruvate carboxykinase [ATP] OS=Staphylococcus aureus (strain Newman) GN=pckA PE=3 SV=1)

HSP 1 Score: 307.375 bits (786), Expect = 9.892e-83
Identity = 149/269 (55.39%), Postives = 183/269 (68.03%), Query Frame = 2
Query:   65 DHNRYLIGDDEHCWGDNGVSNIEGGCYAKCIDLSREKEPDIWNAIKFGAVLENVVFDEHTREVDYSDKSVTENTRAAYPIEYIPNAKIPCVGPHPKNVILLACDAFGVLPPVSKLNLAQTMYHFISGYTALVAGTEDGIKEPTATFSACFGAAFIMLHPTKYAAMLAEKMQKHGATGWLVNTGWSGGSYGCGSRIKLPYTRKIIDAIHSGSLLNANYKKTDVFGVEIPTEVEGVPSEILDPENTWADKQAYKETLLKLAGLFKRNFEIF 871
            D +R LIGDDEH W  NGV NIEGGCYAK I+LS+EKEP I++AIK+GA+LEN V  E    VD+ D   TENTRAAYPI +I N  +P    HP  +I L  DAFGV+PP+SKLN  Q MYHF+SG+T+ +AGTE G+ EP  +FS CFGA F  LHPT YA +L E +  H    +LVNTGW+GG YG G RI L YTR++++   SG L NA Y K   FG+ IP E+E VP  IL+P N W+DK+ YK     L   F++NFE F
Sbjct:  248 DPHRKLIGDDEHGWNKNGVFNIEGGCYAKAINLSKEKEPQIFDAIKYGAILENTVVAEDG-SVDFEDNRYTENTRAAYPINHIDNIVVPSKAAHPNTIIFLTADAFGVIPPISKLNKDQAMYHFLSGFTSKLAGTERGVTEPEPSFSTCFGAPFFPLHPTVYADLLGELIDLHDVDVYLVNTGWTGGKYGVGRRISLHYTRQMVNQAISGKLKNAEYTKDSTFGLSIPVEIEDVPKTILNPINAWSDKEKYKAQAEDLIQRFEKNFEKF 515          
BLAST of DC900116 vs. ExPASy Swiss-Prot
Match: PCKA_STAAC (Phosphoenolpyruvate carboxykinase [ATP] OS=Staphylococcus aureus (strain COL) GN=pckA PE=3 SV=1)

HSP 1 Score: 307.375 bits (786), Expect = 9.892e-83
Identity = 149/269 (55.39%), Postives = 183/269 (68.03%), Query Frame = 2
Query:   65 DHNRYLIGDDEHCWGDNGVSNIEGGCYAKCIDLSREKEPDIWNAIKFGAVLENVVFDEHTREVDYSDKSVTENTRAAYPIEYIPNAKIPCVGPHPKNVILLACDAFGVLPPVSKLNLAQTMYHFISGYTALVAGTEDGIKEPTATFSACFGAAFIMLHPTKYAAMLAEKMQKHGATGWLVNTGWSGGSYGCGSRIKLPYTRKIIDAIHSGSLLNANYKKTDVFGVEIPTEVEGVPSEILDPENTWADKQAYKETLLKLAGLFKRNFEIF 871
            D +R LIGDDEH W  NGV NIEGGCYAK I+LS+EKEP I++AIK+GA+LEN V  E    VD+ D   TENTRAAYPI +I N  +P    HP  +I L  DAFGV+PP+SKLN  Q MYHF+SG+T+ +AGTE G+ EP  +FS CFGA F  LHPT YA +L E +  H    +LVNTGW+GG YG G RI L YTR++++   SG L NA Y K   FG+ IP E+E VP  IL+P N W+DK+ YK     L   F++NFE F
Sbjct:  248 DPHRKLIGDDEHGWNKNGVFNIEGGCYAKAINLSKEKEPQIFDAIKYGAILENTVVAEDG-SVDFEDNRYTENTRAAYPINHIDNIVVPSKAAHPNTIIFLTADAFGVIPPISKLNKDQAMYHFLSGFTSKLAGTERGVTEPEPSFSTCFGAPFFPLHPTVYADLLGELIDLHDVDVYLVNTGWTGGKYGVGRRISLHYTRQMVNQAISGKLKNAEYTKDSTFGLSIPVEIEDVPKTILNPINAWSDKEKYKAQAEDLIQRFEKNFEKF 515          
BLAST of DC900116 vs. ExPASy Swiss-Prot
Match: PCKA_STAAB (Phosphoenolpyruvate carboxykinase [ATP] OS=Staphylococcus aureus (strain bovine RF122 / ET3-1) GN=pckA PE=3 SV=1)

HSP 1 Score: 307.375 bits (786), Expect = 9.892e-83
Identity = 149/269 (55.39%), Postives = 183/269 (68.03%), Query Frame = 2
Query:   65 DHNRYLIGDDEHCWGDNGVSNIEGGCYAKCIDLSREKEPDIWNAIKFGAVLENVVFDEHTREVDYSDKSVTENTRAAYPIEYIPNAKIPCVGPHPKNVILLACDAFGVLPPVSKLNLAQTMYHFISGYTALVAGTEDGIKEPTATFSACFGAAFIMLHPTKYAAMLAEKMQKHGATGWLVNTGWSGGSYGCGSRIKLPYTRKIIDAIHSGSLLNANYKKTDVFGVEIPTEVEGVPSEILDPENTWADKQAYKETLLKLAGLFKRNFEIF 871
            D +R LIGDDEH W  NGV NIEGGCYAK I+LS+EKEP I++AIK+GA+LEN V  E    VD+ D   TENTRAAYPI +I N  +P    HP  +I L  DAFGV+PP+SKLN  Q MYHF+SG+T+ +AGTE G+ EP  +FS CFGA F  LHPT YA +L E +  H    +LVNTGW+GG YG G RI L YTR++++   SG L NA Y K   FG+ IP E+E VP  IL+P N W+DK+ YK     L   F++NFE F
Sbjct:  248 DPHRKLIGDDEHGWNKNGVFNIEGGCYAKAINLSKEKEPQIFDAIKYGAILENTVVAEDG-SVDFEDNRYTENTRAAYPINHIDNIVVPSKAAHPNTIIFLTADAFGVIPPISKLNKDQAMYHFLSGFTSKLAGTERGVTEPEPSFSTCFGAPFFPLHPTVYADLLGELIDLHDVDVYLVNTGWTGGKYGVGRRISLHYTRQMVNQAISGKLKNAEYTKDSTFGLSIPVEIEDVPKTILNPINAWSDKEKYKAQAEDLIQRFEKNFEKF 515          
BLAST of DC900116 vs. ExPASy Swiss-Prot
Match: PCKA_STAA9 (Phosphoenolpyruvate carboxykinase [ATP] OS=Staphylococcus aureus (strain JH9) GN=pckA PE=3 SV=1)

HSP 1 Score: 307.375 bits (786), Expect = 9.892e-83
Identity = 149/269 (55.39%), Postives = 183/269 (68.03%), Query Frame = 2
Query:   65 DHNRYLIGDDEHCWGDNGVSNIEGGCYAKCIDLSREKEPDIWNAIKFGAVLENVVFDEHTREVDYSDKSVTENTRAAYPIEYIPNAKIPCVGPHPKNVILLACDAFGVLPPVSKLNLAQTMYHFISGYTALVAGTEDGIKEPTATFSACFGAAFIMLHPTKYAAMLAEKMQKHGATGWLVNTGWSGGSYGCGSRIKLPYTRKIIDAIHSGSLLNANYKKTDVFGVEIPTEVEGVPSEILDPENTWADKQAYKETLLKLAGLFKRNFEIF 871
            D +R LIGDDEH W  NGV NIEGGCYAK I+LS+EKEP I++AIK+GA+LEN V  E    VD+ D   TENTRAAYPI +I N  +P    HP  +I L  DAFGV+PP+SKLN  Q MYHF+SG+T+ +AGTE G+ EP  +FS CFGA F  LHPT YA +L E +  H    +LVNTGW+GG YG G RI L YTR++++   SG L NA Y K   FG+ IP E+E VP  IL+P N W+DK+ YK     L   F++NFE F
Sbjct:  248 DPHRKLIGDDEHGWNKNGVFNIEGGCYAKAINLSKEKEPQIFDAIKYGAILENTVVAEDG-SVDFEDNRYTENTRAAYPINHIDNIVVPSKAAHPNTIIFLTADAFGVIPPISKLNKDQAMYHFLSGFTSKLAGTERGVTEPEPSFSTCFGAPFFPLHPTVYADLLGELIDLHDVDVYLVNTGWTGGKYGVGRRISLHYTRQMVNQAISGKLKNAEYTKDSTFGLSIPVEIEDVPKTILNPINAWSDKEKYKAQAEDLIQRFEKNFEKF 515          
BLAST of DC900116 vs. ExPASy Swiss-Prot
Match: PCKA_STAA8 (Phosphoenolpyruvate carboxykinase [ATP] OS=Staphylococcus aureus (strain NCTC 8325) GN=pckA PE=3 SV=1)

HSP 1 Score: 307.375 bits (786), Expect = 9.892e-83
Identity = 149/269 (55.39%), Postives = 183/269 (68.03%), Query Frame = 2
Query:   65 DHNRYLIGDDEHCWGDNGVSNIEGGCYAKCIDLSREKEPDIWNAIKFGAVLENVVFDEHTREVDYSDKSVTENTRAAYPIEYIPNAKIPCVGPHPKNVILLACDAFGVLPPVSKLNLAQTMYHFISGYTALVAGTEDGIKEPTATFSACFGAAFIMLHPTKYAAMLAEKMQKHGATGWLVNTGWSGGSYGCGSRIKLPYTRKIIDAIHSGSLLNANYKKTDVFGVEIPTEVEGVPSEILDPENTWADKQAYKETLLKLAGLFKRNFEIF 871
            D +R LIGDDEH W  NGV NIEGGCYAK I+LS+EKEP I++AIK+GA+LEN V  E    VD+ D   TENTRAAYPI +I N  +P    HP  +I L  DAFGV+PP+SKLN  Q MYHF+SG+T+ +AGTE G+ EP  +FS CFGA F  LHPT YA +L E +  H    +LVNTGW+GG YG G RI L YTR++++   SG L NA Y K   FG+ IP E+E VP  IL+P N W+DK+ YK     L   F++NFE F
Sbjct:  248 DPHRKLIGDDEHGWNKNGVFNIEGGCYAKAINLSKEKEPQIFDAIKYGAILENTVVAEDG-SVDFEDNRYTENTRAAYPINHIDNIVVPSKAAHPNTIIFLTADAFGVIPPISKLNKDQAMYHFLSGFTSKLAGTERGVTEPEPSFSTCFGAPFFPLHPTVYADLLGELIDLHDVDVYLVNTGWTGGKYGVGRRISLHYTRQMVNQAISGKLKNAEYTKDSTFGLSIPVEIEDVPKTILNPINAWSDKEKYKAQAEDLIQRFEKNFEKF 515          
BLAST of DC900116 vs. ExPASy Swiss-Prot
Match: PCKA_STAA3 (Phosphoenolpyruvate carboxykinase [ATP] OS=Staphylococcus aureus (strain USA300) GN=pckA PE=3 SV=1)

HSP 1 Score: 307.375 bits (786), Expect = 9.892e-83
Identity = 149/269 (55.39%), Postives = 183/269 (68.03%), Query Frame = 2
Query:   65 DHNRYLIGDDEHCWGDNGVSNIEGGCYAKCIDLSREKEPDIWNAIKFGAVLENVVFDEHTREVDYSDKSVTENTRAAYPIEYIPNAKIPCVGPHPKNVILLACDAFGVLPPVSKLNLAQTMYHFISGYTALVAGTEDGIKEPTATFSACFGAAFIMLHPTKYAAMLAEKMQKHGATGWLVNTGWSGGSYGCGSRIKLPYTRKIIDAIHSGSLLNANYKKTDVFGVEIPTEVEGVPSEILDPENTWADKQAYKETLLKLAGLFKRNFEIF 871
            D +R LIGDDEH W  NGV NIEGGCYAK I+LS+EKEP I++AIK+GA+LEN V  E    VD+ D   TENTRAAYPI +I N  +P    HP  +I L  DAFGV+PP+SKLN  Q MYHF+SG+T+ +AGTE G+ EP  +FS CFGA F  LHPT YA +L E +  H    +LVNTGW+GG YG G RI L YTR++++   SG L NA Y K   FG+ IP E+E VP  IL+P N W+DK+ YK     L   F++NFE F
Sbjct:  248 DPHRKLIGDDEHGWNKNGVFNIEGGCYAKAINLSKEKEPQIFDAIKYGAILENTVVAEDG-SVDFEDNRYTENTRAAYPINHIDNIVVPSKAAHPNTIIFLTADAFGVIPPISKLNKDQAMYHFLSGFTSKLAGTERGVTEPEPSFSTCFGAPFFPLHPTVYADLLGELIDLHDVDVYLVNTGWTGGKYGVGRRISLHYTRQMVNQAISGKLKNAEYTKDSTFGLSIPVEIEDVPKTILNPINAWSDKEKYKAQAEDLIQRFEKNFEKF 515          
BLAST of DC900116 vs. ExPASy Swiss-Prot
Match: PCKA_STAA2 (Phosphoenolpyruvate carboxykinase [ATP] OS=Staphylococcus aureus (strain JH1) GN=pckA PE=3 SV=1)

HSP 1 Score: 307.375 bits (786), Expect = 9.892e-83
Identity = 149/269 (55.39%), Postives = 183/269 (68.03%), Query Frame = 2
Query:   65 DHNRYLIGDDEHCWGDNGVSNIEGGCYAKCIDLSREKEPDIWNAIKFGAVLENVVFDEHTREVDYSDKSVTENTRAAYPIEYIPNAKIPCVGPHPKNVILLACDAFGVLPPVSKLNLAQTMYHFISGYTALVAGTEDGIKEPTATFSACFGAAFIMLHPTKYAAMLAEKMQKHGATGWLVNTGWSGGSYGCGSRIKLPYTRKIIDAIHSGSLLNANYKKTDVFGVEIPTEVEGVPSEILDPENTWADKQAYKETLLKLAGLFKRNFEIF 871
            D +R LIGDDEH W  NGV NIEGGCYAK I+LS+EKEP I++AIK+GA+LEN V  E    VD+ D   TENTRAAYPI +I N  +P    HP  +I L  DAFGV+PP+SKLN  Q MYHF+SG+T+ +AGTE G+ EP  +FS CFGA F  LHPT YA +L E +  H    +LVNTGW+GG YG G RI L YTR++++   SG L NA Y K   FG+ IP E+E VP  IL+P N W+DK+ YK     L   F++NFE F
Sbjct:  248 DPHRKLIGDDEHGWNKNGVFNIEGGCYAKAINLSKEKEPQIFDAIKYGAILENTVVAEDG-SVDFEDNRYTENTRAAYPINHIDNIVVPSKAAHPNTIIFLTADAFGVIPPISKLNKDQAMYHFLSGFTSKLAGTERGVTEPEPSFSTCFGAPFFPLHPTVYADLLGELIDLHDVDVYLVNTGWTGGKYGVGRRISLHYTRQMVNQAISGKLKNAEYTKDSTFGLSIPVEIEDVPKTILNPINAWSDKEKYKAQAEDLIQRFEKNFEKF 515          
BLAST of DC900116 vs. ExPASy Swiss-Prot
Match: PCKA_STAA1 (Phosphoenolpyruvate carboxykinase [ATP] OS=Staphylococcus aureus (strain Mu3 / ATCC 700698) GN=pckA PE=3 SV=1)

HSP 1 Score: 307.375 bits (786), Expect = 9.892e-83
Identity = 149/269 (55.39%), Postives = 183/269 (68.03%), Query Frame = 2
Query:   65 DHNRYLIGDDEHCWGDNGVSNIEGGCYAKCIDLSREKEPDIWNAIKFGAVLENVVFDEHTREVDYSDKSVTENTRAAYPIEYIPNAKIPCVGPHPKNVILLACDAFGVLPPVSKLNLAQTMYHFISGYTALVAGTEDGIKEPTATFSACFGAAFIMLHPTKYAAMLAEKMQKHGATGWLVNTGWSGGSYGCGSRIKLPYTRKIIDAIHSGSLLNANYKKTDVFGVEIPTEVEGVPSEILDPENTWADKQAYKETLLKLAGLFKRNFEIF 871
            D +R LIGDDEH W  NGV NIEGGCYAK I+LS+EKEP I++AIK+GA+LEN V  E    VD+ D   TENTRAAYPI +I N  +P    HP  +I L  DAFGV+PP+SKLN  Q MYHF+SG+T+ +AGTE G+ EP  +FS CFGA F  LHPT YA +L E +  H    +LVNTGW+GG YG G RI L YTR++++   SG L NA Y K   FG+ IP E+E VP  IL+P N W+DK+ YK     L   F++NFE F
Sbjct:  248 DPHRKLIGDDEHGWNKNGVFNIEGGCYAKAINLSKEKEPQIFDAIKYGAILENTVVAEDG-SVDFEDNRYTENTRAAYPINHIDNIVVPSKAAHPNTIIFLTADAFGVIPPISKLNKDQAMYHFLSGFTSKLAGTERGVTEPEPSFSTCFGAPFFPLHPTVYADLLGELIDLHDVDVYLVNTGWTGGKYGVGRRISLHYTRQMVNQAISGKLKNAEYTKDSTFGLSIPVEIEDVPKTILNPINAWSDKEKYKAQAEDLIQRFEKNFEKF 515          
BLAST of DC900116 vs. ExPASy Swiss-Prot
Match: PCKA_GEOSM (Phosphoenolpyruvate carboxykinase [ATP] OS=Geobacter sp. (strain M21) GN=pckA PE=3 SV=1)

HSP 1 Score: 307.375 bits (786), Expect = 9.892e-83
Identity = 147/268 (54.85%), Postives = 188/268 (70.15%), Query Frame = 2
Query:   71 NRYLIGDDEHCWGDNGVSNIEGGCYAKCIDLSREKEPDIWNAI-KFGAVLENVVFDEHTREVDYSDKSVTENTRAAYPIEYIPNAKIPCVGPHPKNVILLACDAFGVLPPVSKLNLAQTMYHFISGYTALVAGTEDGIKEPTATFSACFGAAFIMLHPTKYAAMLAEKMQKHGATGWLVNTGWSGGSYGCGSRIKLPYTRKIIDAIHSGSLLNANYKKTDVFGVEIPTEVEGVPSEILDPENTWADKQAYKETLLKLAGLFKRNFEIF 871
            NR LIGDDEH W D GV N EGGCYAK I+LS + EP+I+    KFG +LENV  D  +R +D  D S TENTRA+YPI +IPN      G HP +VI+L CDAFGVLPP+++L  AQ MYHF+SGYTA VAGTE G+ EP ATFSACFGA F+ L P+ YA +L +K+  H  + WLVNTGWSGG  G G R+K+ Y+R +++A   G+L   ++ K  VFG++IP+   G+P++IL+P N W+DK AY  T  KL  +F+ NFE F
Sbjct:  250 NRLLIGDDEHGWDDAGVFNFEGGCYAKVINLSPQSEPEIYQCTRKFGTILENVAIDTISRRIDLDDASFTENTRASYPITHIPNIVGEGCGGHPNHVIMLTCDAFGVLPPIARLTPAQAMYHFLSGYTAKVAGTEAGVTEPQATFSACFGAPFMALRPSLYADLLGKKIASHKVSCWLVNTGWSGGGPGIGGRMKIAYSRALVNAALDGTLGAGSFVKDSVFGLDIPSACPGLPADILNPRNVWSDKSAYDATAHKLVEMFRHNFEQF 517          
The following BLAST results are available for this feature:
BLAST of DC900116 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 284
Match NameE-valueIdentityDescription
PCKA_STAAM9.892e-8355.39Phosphoenolpyruvate carboxykinase [ATP] OS=Staphyl... [more]
PCKA_STAAE9.892e-8355.39Phosphoenolpyruvate carboxykinase [ATP] OS=Staphyl... [more]
PCKA_STAAC9.892e-8355.39Phosphoenolpyruvate carboxykinase [ATP] OS=Staphyl... [more]
PCKA_STAAB9.892e-8355.39Phosphoenolpyruvate carboxykinase [ATP] OS=Staphyl... [more]
PCKA_STAA99.892e-8355.39Phosphoenolpyruvate carboxykinase [ATP] OS=Staphyl... [more]
PCKA_STAA89.892e-8355.39Phosphoenolpyruvate carboxykinase [ATP] OS=Staphyl... [more]
PCKA_STAA39.892e-8355.39Phosphoenolpyruvate carboxykinase [ATP] OS=Staphyl... [more]
PCKA_STAA29.892e-8355.39Phosphoenolpyruvate carboxykinase [ATP] OS=Staphyl... [more]
PCKA_STAA19.892e-8355.39Phosphoenolpyruvate carboxykinase [ATP] OS=Staphyl... [more]
PCKA_GEOSM9.892e-8354.85Phosphoenolpyruvate carboxykinase [ATP] OS=Geobact... [more]

Pages

back to top
Properties
Property NameValue
Genbank descriptionDC900116 VSS Citrus sinensis cDNA clone VS27V30 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900116 ID=DC900116|Name=DC900116|organism=Citrus sinensis|type=EST|length=1107bp
AAAAGATGGCNATGTTGCCCTCTTCTTTGGATTGTCAGGTACTGGAAAGA
CAACACTGTCTACTGATCACAATCGATATCTGATTGGAGACGATGAACAC
TGTTGGGGTGACAATGGTGTGTCAAACATTGAGGGTGGTTGCTATGCCAA
GTGCATTGATCTCTCAAGGGAGAAGGAGCCTGATATCTGGAATGCCATCA
AGTTTGGCGCTGTGTTGGAAAATGTTGTGTTTGATGAGCATACCAGAGAG
GTGGATTATTCTGACAAATCTGTCACAGAGAACACTCGTGCTGCCTACCC
CATTGAGTATATCCCCAATGCAAAGATACCATGCGTTGGTCCTCATCCCA
AGAATGTCATCCTTTTGGCATGTGATGCTTTTGGTGTACTCCCACCAGTG
AGCAAGCTGAACCTGGCACAAACAATGTACCATTTCATCAGTGGCTACAC
TGCTTTGGTAGCTGGAACAGAGGATGGTATTAAGGAGCCAACGGCAACAT
TTTCAGCTTGCTTTGGTGCAGCATTTATCATGCTGCATCCTACCAAGTAT
GCAGCAATGCTGGCTGAGAAGATGCAGAAGCATGGTGCTACAGGATGGCT
CGTCAACACTGGATGGTCAGGTGGAAGCTATGGTTGTGGCAGCCGCATCA
AGTTACCGTACACTCGAAAAATCATTGATGCGATACACTCTGGCAGCCTG
TTGAATGCAAATTACAAGAAAACTGATGTATTTGGGGTGGAAATCCCCAC
TGAAGTCGAGGGAGTGCCTTCAGAAATCCTGGATCCAGAGAACACTTGGG
CAGACAAGCAGGCTTACAAGGAGACACTGCTGAAGCTGGCTGGTCTTTTC
AAGAGGAACTTTGAAATATTCACAAACTACAAGATTGGCAAGGACAACAA
GCTCACTGAAGAGATCCTTGNANCTGGTCCAAATTTCTAATTTAGACCGA
GTGAAGAACAAGCAAAGAACGTGAGTGTGGTTTGGGAAATATGATGGAAA
TAAAGCGTAATATAGTCATATTCGACATGTGTGGTTCGATTCATATGTAA
ACTTGTTCTCCTGNATTAATTAAGTAATCCAAAAATTTGAGTCANCGATT
TTAATTA
back to top