DC900116

Overview
NameDC900116
Unique NameDC900116
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length1107
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig3510 contig Csv1_Contig3510:263..1369. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Homology
BLAST of DC900116 vs. ExPASy Swiss-Prot
Match: PCKA_RHOS5 (Phosphoenolpyruvate carboxykinase [ATP] OS=Rhodobacter sphaeroides (strain ATCC 17025 / ATH 2.4.3) GN=pckA PE=3 SV=1)

HSP 1 Score: 306.99 bits (785), Expect = 1.292e-82
Identity = 147/273 (53.85%), Postives = 185/273 (67.77%), Query Frame = 2
Query:   65 DHNRYLIGDDEHCWGDNGVSNIEGGCYAKCIDLSREKEPDIW-NAIKFGAVLENVVFDEHTREVDYSDKSVTENTRAAYPIEYIPNAKIPCVGPHPKNVILLACDAFGVLPPVSKLNLAQTMYHFISGYTALVAGTEDGIKEPTATFSACFGAAFIMLHPTKYAAMLAEKMQKHGATGWLVNTGWSGGSYGCGSRIKLPYTRKIIDAIHSGSLLNANYKKTDVFGVEIPTEVEGVPSEILDPENTWADKQAYKETLLKLAGLFKRNFEIFTNY 880
            D +R LIGDDEH W D G  N EGGCYAK I+LS E EP+I+    KF  V+EN+V++E T E+D+ D S+T NTR AYP+EYI NA    +G HPKNVI+L CDAFGVLPP+++L  AQ MYHF+SG+T+ VAGTE G+ EP  TFS CFGA F+   P  Y  +L EK+   GAT WLVNTGW+GG+YG G R+ +  TR ++ A   GSL N  ++K   FG E+PTE+ GV S +LDP +TWAD  AY     KL  +F  NF  +  Y
Sbjct:  249 DPSRTLIGDDEHGWSDKGTFNFEGGCYAKTINLSPEAEPEIYATTSKFATVVENMVYNEETLELDFDDDSLTANTRCAYPLEYISNASATGMGGHPKNVIMLTCDAFGVLPPIARLTPAQAMYHFLSGFTSKVAGTERGVTEPQPTFSTCFGAPFMPRRPEVYGKLLQEKITSLGATCWLVNTGWTGGAYGTGKRMPIKATRALLTAALDGSLANVTFRKDPNFGFEVPTELHGVDSSLLDPRSTWADPAAYDAQAKKLVEMFANNFAQYVPY 521          
BLAST of DC900116 vs. ExPASy Swiss-Prot
Match: PCKA_PELPD (Phosphoenolpyruvate carboxykinase [ATP] OS=Pelobacter propionicus (strain DSM 2379) GN=pckA PE=3 SV=1)

HSP 1 Score: 306.99 bits (785), Expect = 1.292e-82
Identity = 143/273 (52.38%), Postives = 186/273 (68.13%), Query Frame = 2
Query:   65 DHNRYLIGDDEHCWGDNGVSNIEGGCYAKCIDLSREKEPDIWNAIK-FGAVLENVVFDEHTREVDYSDKSVTENTRAAYPIEYIPNAKIPCVGPHPKNVILLACDAFGVLPPVSKLNLAQTMYHFISGYTALVAGTEDGIKEPTATFSACFGAAFIMLHPTKYAAMLAEKMQKHGATGWLVNTGWSGGSYGCGSRIKLPYTRKIIDAIHSGSLLNANYKKTDVFGVEIPTEVEGVPSEILDPENTWADKQAYKETLLKLAGLFKRNFEIFTNY 880
            D +R LIGDDEH W D G+ N EGGCYAK I L  E EP+I+   + FG +LENV  +  TR VD  D S TENTRA+YP+ +IPN     +  HP N+I+L CDA+GVLPP+S L   Q MYHF+SGYTA VAGTE G+KEPTATFS CFG  F+ L+PT Y  +L EK+ +H  + WLVNTGW+GG YG G RI++ Y+R +I+A   G+L + +++    FG+ IPT   GVPSE+L+P NTW+D   Y +T  +L  +F+ NF  +  Y
Sbjct:  249 DSSRALIGDDEHGWDDKGLFNFEGGCYAKIIRLCPESEPEIFATTRRFGTILENVAINTRTRRVDLDDDSFTENTRASYPLTHIPNIVPSGIAGHPANIIMLTCDAYGVLPPISHLTKEQAMYHFLSGYTARVAGTEAGVKEPTATFSTCFGGPFMALNPTVYGELLREKISRHNVSCWLVNTGWNGGPYGVGERIRISYSRALINAALDGTLADGSFETDPFFGLAIPTSCPGVPSEMLNPRNTWSDPARYDDTASRLVAMFRSNFTKYQPY 521          
BLAST of DC900116 vs. ExPASy Swiss-Prot
Match: PCKA_STAAW (Phosphoenolpyruvate carboxykinase [ATP] OS=Staphylococcus aureus (strain MW2) GN=pckA PE=3 SV=1)

HSP 1 Score: 305.834 bits (782), Expect = 2.878e-82
Identity = 148/269 (55.02%), Postives = 183/269 (68.03%), Query Frame = 2
Query:   65 DHNRYLIGDDEHCWGDNGVSNIEGGCYAKCIDLSREKEPDIWNAIKFGAVLENVVFDEHTREVDYSDKSVTENTRAAYPIEYIPNAKIPCVGPHPKNVILLACDAFGVLPPVSKLNLAQTMYHFISGYTALVAGTEDGIKEPTATFSACFGAAFIMLHPTKYAAMLAEKMQKHGATGWLVNTGWSGGSYGCGSRIKLPYTRKIIDAIHSGSLLNANYKKTDVFGVEIPTEVEGVPSEILDPENTWADKQAYKETLLKLAGLFKRNFEIF 871
            D +R LIGDDEH W  NGV NIEGGCYAK I+LS+EKEP I++AIK+GA+LEN V  E    VD+ D   TENTRAAYPI +I N  +P    HP  +I L  DAFGV+PP+SKLN  Q MYHF+SG+T+ +AGTE G+ EP  +FS CFGA F  LHPT YA +L E +  H    +LVNTGW+GG YG G RI L YTR++++   SG L NA Y K   FG+ IP ++E VP  IL+P N W+DK+ YK     L   F++NFE F
Sbjct:  248 DPHRKLIGDDEHGWNKNGVFNIEGGCYAKAINLSKEKEPQIFDAIKYGAILENTVVAEDG-SVDFEDNRYTENTRAAYPINHIDNIVVPSKAAHPNTIIFLTADAFGVIPPISKLNKDQAMYHFLSGFTSKLAGTERGVTEPEPSFSTCFGAPFFPLHPTVYADLLGELIDLHDVDVYLVNTGWTGGKYGVGRRISLHYTRQMVNQAISGKLKNAEYTKDSTFGLSIPVKIEDVPKTILNPINAWSDKEKYKAQAEDLIQRFEKNFEKF 515          
BLAST of DC900116 vs. ExPASy Swiss-Prot
Match: PCKA_STAAS (Phosphoenolpyruvate carboxykinase [ATP] OS=Staphylococcus aureus (strain MSSA476) GN=pckA PE=3 SV=1)

HSP 1 Score: 305.834 bits (782), Expect = 2.878e-82
Identity = 148/269 (55.02%), Postives = 183/269 (68.03%), Query Frame = 2
Query:   65 DHNRYLIGDDEHCWGDNGVSNIEGGCYAKCIDLSREKEPDIWNAIKFGAVLENVVFDEHTREVDYSDKSVTENTRAAYPIEYIPNAKIPCVGPHPKNVILLACDAFGVLPPVSKLNLAQTMYHFISGYTALVAGTEDGIKEPTATFSACFGAAFIMLHPTKYAAMLAEKMQKHGATGWLVNTGWSGGSYGCGSRIKLPYTRKIIDAIHSGSLLNANYKKTDVFGVEIPTEVEGVPSEILDPENTWADKQAYKETLLKLAGLFKRNFEIF 871
            D +R LIGDDEH W  NGV NIEGGCYAK I+LS+EKEP I++AIK+GA+LEN V  E    VD+ D   TENTRAAYPI +I N  +P    HP  +I L  DAFGV+PP+SKLN  Q MYHF+SG+T+ +AGTE G+ EP  +FS CFGA F  LHPT YA +L E +  H    +LVNTGW+GG YG G RI L YTR++++   SG L NA Y K   FG+ IP ++E VP  IL+P N W+DK+ YK     L   F++NFE F
Sbjct:  248 DPHRKLIGDDEHGWNKNGVFNIEGGCYAKAINLSKEKEPQIFDAIKYGAILENTVVAEDG-SVDFEDNRYTENTRAAYPINHIDNIVVPSKAAHPNTIIFLTADAFGVIPPISKLNKDQAMYHFLSGFTSKLAGTERGVTEPEPSFSTCFGAPFFPLHPTVYADLLGELIDLHDVDVYLVNTGWTGGKYGVGRRISLHYTRQMVNQAISGKLKNAEYTKDSTFGLSIPVKIEDVPKTILNPINAWSDKEKYKAQAEDLIQRFEKNFEKF 515          
BLAST of DC900116 vs. ExPASy Swiss-Prot
Match: PCKA_RHOS4 (Phosphoenolpyruvate carboxykinase [ATP] OS=Rhodobacter sphaeroides (strain ATCC 17023 / 2.4.1 / NCIB 8253 / DSM 158) GN=pckA PE=3 SV=1)

HSP 1 Score: 305.834 bits (782), Expect = 2.878e-82
Identity = 143/267 (53.56%), Postives = 186/267 (69.66%), Query Frame = 2
Query:   65 DHNRYLIGDDEHCWGDNGVSNIEGGCYAKCIDLSREKEPDIW-NAIKFGAVLENVVFDEHTREVDYSDKSVTENTRAAYPIEYIPNAKIPCVGPHPKNVILLACDAFGVLPPVSKLNLAQTMYHFISGYTALVAGTEDGIKEPTATFSACFGAAFIMLHPTKYAAMLAEKMQKHGATGWLVNTGWSGGSYGCGSRIKLPYTRKIIDAIHSGSLLNANYKKTDVFGVEIPTEVEGVPSEILDPENTWADKQAYKETLLKLAGLFKRNF 862
            D +R LIGDDEH W D G  N EGGCYAK I+LS E EP+I+    KF  V+EN+V+DE T E+D++D S+T NTR AYP++YI NA    +G HPKNVI+L CDAFGVLPP+++L  AQ MYHF+SG+T+ VAGTE G+ EP  TFS CFGA F+   P  Y  +L EK+ KHGAT WLVNTGW+GG+YG G R+ +  TR ++ A   GSL    +++   FG E+P ++ GV +++LDP +TWAD  AY +   KL  +F  NF
Sbjct:  249 DPSRTLIGDDEHGWSDRGTFNFEGGCYAKTINLSAEAEPEIYATTSKFATVVENMVYDEETLELDFNDDSLTANTRCAYPLDYISNASESGLGGHPKNVIMLTCDAFGVLPPIARLTPAQAMYHFLSGFTSKVAGTERGVTEPQPTFSTCFGAPFMPRRPEVYGKLLQEKIAKHGATCWLVNTGWTGGAYGTGKRMPIKATRALLTAALDGSLSGVQFRRDPNFGFEVPVDLHGVDAKLLDPRSTWADPAAYDQQAKKLVEMFANNF 515          
BLAST of DC900116 vs. ExPASy Swiss-Prot
Match: PCKA_RHOS1 (Phosphoenolpyruvate carboxykinase [ATP] OS=Rhodobacter sphaeroides (strain ATCC 17029 / ATH 2.4.9) GN=pckA PE=3 SV=1)

HSP 1 Score: 305.834 bits (782), Expect = 2.878e-82
Identity = 143/267 (53.56%), Postives = 186/267 (69.66%), Query Frame = 2
Query:   65 DHNRYLIGDDEHCWGDNGVSNIEGGCYAKCIDLSREKEPDIW-NAIKFGAVLENVVFDEHTREVDYSDKSVTENTRAAYPIEYIPNAKIPCVGPHPKNVILLACDAFGVLPPVSKLNLAQTMYHFISGYTALVAGTEDGIKEPTATFSACFGAAFIMLHPTKYAAMLAEKMQKHGATGWLVNTGWSGGSYGCGSRIKLPYTRKIIDAIHSGSLLNANYKKTDVFGVEIPTEVEGVPSEILDPENTWADKQAYKETLLKLAGLFKRNF 862
            D +R LIGDDEH W D G  N EGGCYAK I+LS E EP+I+    KF  V+EN+V+DE T E+D++D S+T NTR AYP++YI NA    +G HPKNVI+L CDAFGVLPP+++L  AQ MYHF+SG+T+ VAGTE G+ EP  TFS CFGA F+   P  Y  +L EK+ KHGAT WLVNTGW+GG+YG G R+ +  TR ++ A   GSL    +++   FG E+P ++ GV +++LDP +TWAD  AY +   KL  +F  NF
Sbjct:  249 DPSRTLIGDDEHGWSDRGTFNFEGGCYAKTINLSAEAEPEIYATTSKFATVVENMVYDEETLELDFNDDSLTANTRCAYPLDYISNASESGLGGHPKNVIMLTCDAFGVLPPIARLTPAQAMYHFLSGFTSKVAGTERGVTEPQPTFSTCFGAPFMPRRPEVYGKLLQEKIAKHGATCWLVNTGWTGGAYGTGKRMPIKATRALLTAALDGSLSGVQFRRDPNFGFEVPVDLHGVDAKLLDPRSTWADPAAYDQQAKKLVEMFANNF 515          
BLAST of DC900116 vs. ExPASy Swiss-Prot
Match: PCKA_CAMJD (Phosphoenolpyruvate carboxykinase [ATP] OS=Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97) GN=pckA PE=3 SV=1)

HSP 1 Score: 305.834 bits (782), Expect = 2.878e-82
Identity = 154/275 (56.00%), Postives = 192/275 (69.82%), Query Frame = 2
Query:   65 DHNRYLIGDDEHCWGDNGVSNIEGGCYAKCIDLSREKEPDIWNAIKFGAVLENVVFDEHTREVDYSDKSVTENTRAAYPIEYIPNAKIPCVGPHPKNVILLACDAFGVLPPVSKLNLAQTMYHFISGYTALVAGTEDGIKEPTATFSACFGAAFIMLHPTKYAAMLAEKMQKHGATGWLVNTGWSGGSYGCGSRIKLPYTRKIIDAIHSGSLLNANYKKTDVFGVEIPTEVEGVPSEILDPENTWADKQAYKETLLKLAGLFKRNFEIFTNYKIG 889
            D  R LIGDDEH W D GV N EGGCYAK I+L  E EP+I+ AIK  A+LENVV     + VDY+D S TENTR +YPIE+I N +      HPKN+I L+ DAFG+LPPVSKL+  Q MY+F+SGYTA VAGTE GI EP ATFSACFG  F+ LHPT YA +L EK++K+    +LVNTGWSGGSYG G R+ +  TR  I+AI  GS+    ++  +VF + IP  +EGV S +L+P NTW+DK AY ET  KLA +F +NF+ + + K G
Sbjct:  241 DPKRKLIGDDEHGWDDEGVFNFEGGCYAKTINLDPEHEPEIYGAIKRNALLENVVL-RADKSVDYADASKTENTRVSYPIEHIENHEPSLKAGHPKNIIFLSADAFGILPPVSKLSKEQAMYYFLSGYTAKVAGTERGITEPQATFSACFGEPFMPLHPTVYARLLGEKIEKYEVNVYLVNTGWSGGSYGVGKRMSIKATRACINAILDGSITKCEFENFEVFDLAIPKALEGVESTLLNPINTWSDKNAYTETRDKLAHMFVQNFKRYEDVKEG 514          
BLAST of DC900116 vs. ExPASy Swiss-Prot
Match: PCKA_RHOPS (Phosphoenolpyruvate carboxykinase [ATP] OS=Rhodopseudomonas palustris (strain BisB5) GN=pckA PE=3 SV=1)

HSP 1 Score: 305.449 bits (781), Expect = 3.759e-82
Identity = 149/270 (55.19%), Postives = 186/270 (68.89%), Query Frame = 2
Query:   65 DHNRYLIGDDEHCWGDNGVSNIEGGCYAKCIDLSREKEPDIWNAI-KFGAVLENVVFDEHTREVDYSDKSVTENTRAAYPIEYIPNAKIPCVGPHPKNVILLACDAFGVLPPVSKLNLAQTMYHFISGYTALVAGTEDGIKEPTATFSACFGAAFIMLHPTKYAAMLAEKMQKHGATGWLVNTGWSGGSYGCGSRIKLPYTRKIIDAIHSGSLLNANYKKTDVFGVEIPTEVEGVPSEILDPENTWADKQAYKETLLKLAGLFKRNFEIF 871
            D NR LIGDDEH WG +GV N EGGCYAKCI LS E EP+I+ A  +FGAVLENVV DE TR+ D+ + S TENTR+AYP+E IPNA        PKNV++LA DAFGV+PP++KL  AQ MYHF+SGYTA VAGTE G+ EPT  FS CFG+ F+   P+ Y  ML + +  H    WLVNTGW+GG YG G R+ +  TR ++ A   GSL NA ++    FG  +PT + GVPS+IL+P  TWADK  + +T   L G+F++NF  F
Sbjct:  248 DPNRTLIGDDEHGWGKDGVFNFEGGCYAKCIKLSPEAEPEIFAASSRFGAVLENVVLDEITRKPDFDNGSKTENTRSAYPLESIPNASPTGRAGQPKNVVMLAADAFGVMPPIAKLTPAQAMYHFLSGYTAKVAGTERGVTEPTPEFSTCFGSPFLPRDPSVYGNMLRDLIHNHNVDCWLVNTGWTGGKYGTGHRMPIKVTRALLTAALDGSLRNAEFRTDPYFGFAVPTALPGVPSDILEPAKTWADKAEFDKTARALVGMFQKNFAKF 517          
BLAST of DC900116 vs. ExPASy Swiss-Prot
Match: PCKA_CAMJE (Phosphoenolpyruvate carboxykinase [ATP] OS=Campylobacter jejuni GN=pckA PE=1 SV=1)

HSP 1 Score: 303.523 bits (776), Expect = 1.428e-81
Identity = 154/275 (56.00%), Postives = 190/275 (69.09%), Query Frame = 2
Query:   65 DHNRYLIGDDEHCWGDNGVSNIEGGCYAKCIDLSREKEPDIWNAIKFGAVLENVVFDEHTREVDYSDKSVTENTRAAYPIEYIPNAKIPCVGPHPKNVILLACDAFGVLPPVSKLNLAQTMYHFISGYTALVAGTEDGIKEPTATFSACFGAAFIMLHPTKYAAMLAEKMQKHGATGWLVNTGWSGGSYGCGSRIKLPYTRKIIDAIHSGSLLNANYKKTDVFGVEIPTEVEGVPSEILDPENTWADKQAYKETLLKLAGLFKRNFEIFTNYKIG 889
            D  R LIGDDEH W D GV N EGGCYAK I+L  E EP+I+ AIK  A+LENVV     + VDY+D S TENTR +YPIE+I N +      HPKN+I L+ DAFG+LPPVSKL+  Q MY+F+SGYTA VAGTE GI EP ATFSACFG  F+ LHPT YA +L EK++KH    +LVNTGWSGGSYG G R+ +  TR  I+AI  GS+    ++  +VF + IP  +EGV S +L+P NTW DK AY  T  KLA +F +NF+ + + K G
Sbjct:  241 DPKRRLIGDDEHGWDDEGVFNFEGGCYAKTINLDPEHEPEIYGAIKRNALLENVVL-RADKSVDYADASKTENTRVSYPIEHIENHEPSLKAGHPKNIIFLSADAFGILPPVSKLSKEQAMYYFLSGYTAKVAGTERGITEPQATFSACFGEPFMPLHPTVYARLLGEKIEKHEVNVYLVNTGWSGGSYGVGKRMSIKATRACINAILDGSITKCEFENFEVFDLAIPKALEGVESVLLNPINTWLDKNAYIATRDKLAHMFIQNFKRYEDVKEG 514          
BLAST of DC900116 vs. ExPASy Swiss-Prot
Match: PCKA_STACT (Phosphoenolpyruvate carboxykinase [ATP] OS=Staphylococcus carnosus (strain TM300) GN=pckA PE=3 SV=1)

HSP 1 Score: 302.753 bits (774), Expect = 2.436e-81
Identity = 143/277 (51.62%), Postives = 189/277 (68.23%), Query Frame = 2
Query:   71 NRYLIGDDEHCWGDNGVSNIEGGCYAKCIDLSREKEPDIWNAIKFGAVLENVVFDEHTREVDYSDKSVTENTRAAYPIEYIPNAKIPCVGPHPKNVILLACDAFGVLPPVSKLNLAQTMYHFISGYTALVAGTEDGIKEPTATFSACFGAAFIMLHPTKYAAMLAEKMQKHGATGWLVNTGWSGGSYGCGSRIKLPYTRKIIDAIHSGSLLNANYKKTDVFGVEIPTEVEGVPSEILDPENTWADKQAYKETLLKLAGLFKRNFEIFTNYKIGKDNK 901
            +R LIGDDEH W  NG+ NIEGGCYAK I+LS+EKEP I++AI++G +LENVV +E    VD+ D   TENTRAAYPI+YI N   P    HP  ++ L  DAFGVLPP+SKL   Q +YHF+SG+T+ +AGTE GI EP  +FS CFGA F+ L+P +YA +L + + KH    +LVNTGW+GG YG G RI L YTR+++DA   G L NA ++K +VFG+ +P +++ VP  IL P N W+++ AY+E    L   F  NF+     K G D+K
Sbjct:  250 DRKLIGDDEHGWNKNGIFNIEGGCYAKAINLSKEKEPQIYDAIRYGTILENVVVEEDGN-VDFDDNKYTENTRAAYPIDYIDNIAKPSKAAHPNTILFLTADAFGVLPPISKLTKEQALYHFLSGFTSKLAGTERGITEPVPSFSTCFGAPFLPLNPKRYAELLGQLIDKHEVEVYLVNTGWTGGKYGVGRRISLKYTRRMVDAAIKGELKNAEFEKDEVFGLSVPKDIKDVPKSILQPINAWSNQDAYREQAQDLISRFVENFK-----KFGDDSK 520          
The following BLAST results are available for this feature:
BLAST of DC900116 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 284
Match NameE-valueIdentityDescription
PCKA_RHOS51.292e-8253.85Phosphoenolpyruvate carboxykinase [ATP] OS=Rhodoba... [more]
PCKA_PELPD1.292e-8252.38Phosphoenolpyruvate carboxykinase [ATP] OS=Pelobac... [more]
PCKA_STAAW2.878e-8255.02Phosphoenolpyruvate carboxykinase [ATP] OS=Staphyl... [more]
PCKA_STAAS2.878e-8255.02Phosphoenolpyruvate carboxykinase [ATP] OS=Staphyl... [more]
PCKA_RHOS42.878e-8253.56Phosphoenolpyruvate carboxykinase [ATP] OS=Rhodoba... [more]
PCKA_RHOS12.878e-8253.56Phosphoenolpyruvate carboxykinase [ATP] OS=Rhodoba... [more]
PCKA_CAMJD2.878e-8256.00Phosphoenolpyruvate carboxykinase [ATP] OS=Campylo... [more]
PCKA_RHOPS3.759e-8255.19Phosphoenolpyruvate carboxykinase [ATP] OS=Rhodops... [more]
PCKA_CAMJE1.428e-8156.00Phosphoenolpyruvate carboxykinase [ATP] OS=Campylo... [more]
PCKA_STACT2.436e-8151.62Phosphoenolpyruvate carboxykinase [ATP] OS=Staphyl... [more]

Pages

back to top
Properties
Property NameValue
Genbank descriptionDC900116 VSS Citrus sinensis cDNA clone VS27V30 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900116 ID=DC900116|Name=DC900116|organism=Citrus sinensis|type=EST|length=1107bp
AAAAGATGGCNATGTTGCCCTCTTCTTTGGATTGTCAGGTACTGGAAAGA
CAACACTGTCTACTGATCACAATCGATATCTGATTGGAGACGATGAACAC
TGTTGGGGTGACAATGGTGTGTCAAACATTGAGGGTGGTTGCTATGCCAA
GTGCATTGATCTCTCAAGGGAGAAGGAGCCTGATATCTGGAATGCCATCA
AGTTTGGCGCTGTGTTGGAAAATGTTGTGTTTGATGAGCATACCAGAGAG
GTGGATTATTCTGACAAATCTGTCACAGAGAACACTCGTGCTGCCTACCC
CATTGAGTATATCCCCAATGCAAAGATACCATGCGTTGGTCCTCATCCCA
AGAATGTCATCCTTTTGGCATGTGATGCTTTTGGTGTACTCCCACCAGTG
AGCAAGCTGAACCTGGCACAAACAATGTACCATTTCATCAGTGGCTACAC
TGCTTTGGTAGCTGGAACAGAGGATGGTATTAAGGAGCCAACGGCAACAT
TTTCAGCTTGCTTTGGTGCAGCATTTATCATGCTGCATCCTACCAAGTAT
GCAGCAATGCTGGCTGAGAAGATGCAGAAGCATGGTGCTACAGGATGGCT
CGTCAACACTGGATGGTCAGGTGGAAGCTATGGTTGTGGCAGCCGCATCA
AGTTACCGTACACTCGAAAAATCATTGATGCGATACACTCTGGCAGCCTG
TTGAATGCAAATTACAAGAAAACTGATGTATTTGGGGTGGAAATCCCCAC
TGAAGTCGAGGGAGTGCCTTCAGAAATCCTGGATCCAGAGAACACTTGGG
CAGACAAGCAGGCTTACAAGGAGACACTGCTGAAGCTGGCTGGTCTTTTC
AAGAGGAACTTTGAAATATTCACAAACTACAAGATTGGCAAGGACAACAA
GCTCACTGAAGAGATCCTTGNANCTGGTCCAAATTTCTAATTTAGACCGA
GTGAAGAACAAGCAAAGAACGTGAGTGTGGTTTGGGAAATATGATGGAAA
TAAAGCGTAATATAGTCATATTCGACATGTGTGGTTCGATTCATATGTAA
ACTTGTTCTCCTGNATTAATTAAGTAATCCAAAAATTTGAGTCANCGATT
TTAATTA
back to top