CX671278

Overview
NameCX671278
Unique NameCX671278
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length716
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig9540 contig Csv1_Contig9540:67..782. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Homology
BLAST of CX671278 vs. ExPASy Swiss-Prot
Match: CB4B_SOLLC (Chlorophyll a-b binding protein CP24 10B, chloroplastic OS=Solanum lycopersicum GN=CAP10B PE=3 SV=1)

HSP 1 Score: 75.485 bits (184), Expect = 3.192e-13
Identity = 63/193 (32.64%), Postives = 79/193 (40.93%), Query Frame = 2
Query:  224 PSYLTGEFPGDYGWDTAGLSADPETFAKNRELEVIHCRWAMLGALGCVFPELLARNGVKFGEAVWFKAGAQIFSEGGLDYLGNPSLIHAQSILAIWACQVVLMGAVEGYRIA------------GGPLGEVTDPL--------YPGGS-FDPLGLA---------DDPEAFAELKGKEIKNGRLAMFSMFGFF 712
            P +L G  PGD+G+D  GL  DP      RE E+IH RWAM   LG          G  +    WF+AGA            +P  I   S  ++   Q++LMG VE  R                P  +  +          YPGG  FDPL LA          D E    LK  EIK+ RLAM +M  F+
Sbjct:   68 PEWLDGSLPGDFGFDPLGLGKDPAFLKWYREAELIHGRWAMAAVLGIFV-------GQAWSGIPWFEAGA------------DPGAIAPFSFGSLLGTQLLLMGWVESKRWVDFFDNDSQSIDWATPWSKTAENFANFTGEQGYPGGKFFDPLALAGTLNNGVYVPDTEKLERLKLAEIKHSRLAMLAMLIFY 241          
BLAST of CX671278 vs. ExPASy Swiss-Prot
Match: CB4_SPIOL (Chlorophyll a-b binding protein CP24, chloroplastic OS=Spinacia oleracea PE=2 SV=1)

HSP 1 Score: 75.0998 bits (183), Expect = 4.168e-13
Identity = 63/193 (32.64%), Postives = 80/193 (41.45%), Query Frame = 2
Query:  224 PSYLTGEFPGDYGWDTAGLSADPETFAKNRELEVIHCRWAMLGALGCVFPELLARNGVKFGEAVWFKAGAQIFSEGGLDYLGNPSLIHAQSILAIWACQVVLMGAVEGYR--------------------IAGGPLGEVTDPLYPGGSF-DPLGLAD---------DPEAFAELKGKEIKNGRLAMFSMFGFF 712
            P +L G  PGD+G+D  GL  DP      RE E+IH RWAML  LG    +  A  G+      WF+AGA            +P  +   S   +   Q++LMG VE  R                     A        +  YPGG F DPL LA          D +    LK  EIK+ RLAM +M  F+
Sbjct:   73 PEWLDGSLPGDFGFDPLGLGKDPAFLKWYREAELIHGRWAMLAVLGIFVGQ--AWTGIP-----WFEAGA------------DPGAVAPFSFGTLLGTQLLLMGWVESKRWVDFFDPDSQSVEWATPWSRTAENFSNSTGEQGYPGGKFFDPLSLAGTISNGVYNPDTDKLERLKLAEIKHARLAMLAMLIFY 246          
BLAST of CX671278 vs. ExPASy Swiss-Prot
Match: CB29_CHLRE (Chlorophyll a-b binding protein CP29 OS=Chlamydomonas reinhardtii GN=Lhcb4 PE=1 SV=3)

HSP 1 Score: 74.7146 bits (182), Expect = 5.444e-13
Identity = 81/245 (33.06%), Postives = 97/245 (39.59%), Query Frame = 2
Query:  140 TGSKSVSSGSPWYGPDRVKYLGPLSGEP----PSYLTGEFPGDYGWDTAGLSADPE-----------TFAKN----------------------------------RELEVIHCRWAMLGALGCVFPELLARNGVKFGEAVWFKAGAQIFSEGGLDYLGNPSLIHAQSILAIWACQVVLMGAVEGYRIAGGPLGEVTDP---LYPGGSFDPLGLA-DDPEAFAELKGKEIKNGRLAMFSMFGFFV 715
            T   + S+G+   G    KY G     P    P +L G  PGD G+D  GLS   E             AKN                                  RE E+IH RWAML  LG +  E  A  GV      W +AG       G  Y G   L    SI  +   +V+L+G  E YR         T+P    YPGG FDPL LA +D E    LK  EIK+ RLAM S FG+ V
Sbjct:   28 TKKVATSTGTRSGGVGYRKYQGDALWLPNTTRPEWLDGSLPGDRGFDPLGLSKPSEFVVIGVDENDQNAAKNNKGSVEAIVQATPDEVSSENRLAPYSEVFGLARFRECELIHGRWAMLACLGALVAE--ATTGVS-----WVEAGK--VELDGASYAG---LSLPFSITQLIWIEVILVGGAEFYR------NSETNPEKRCYPGGVFDPLKLASEDEERAFRLKTAEIKHARLAMVSFFGYGV 254          
The following BLAST results are available for this feature:
BLAST of CX671278 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 83
Match NameE-valueIdentityDescription
CB4B_SOLLC3.192e-1332.64Chlorophyll a-b binding protein CP24 10B, chloropl... [more]
CB4_SPIOL4.168e-1332.64Chlorophyll a-b binding protein CP24, chloroplasti... [more]
CB29_CHLRE5.444e-1333.06Chlorophyll a-b binding protein CP29 OS=Chlamydomo... [more]

Pages

back to top
Properties
Property NameValue
Genbank descriptionUCRCS10_10A12_g Madame Vinous Sweet Orange Multiple Pathogen-Infected cDNA Library UCRCS10 Citrus sinensis cDNA clone UCRCS10-10A12-A24-5.g, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX671278 ID=CX671278|Name=CX671278|organism=Citrus sinensis|type=EST|length=716bp
CACAGCTTCTGCTTCTCAATTAAATTCCTCAATGGCAACCTCGACCATGG
CTCTCTCCTCATCATTCGTCGGCAAGGCTGTGAACCTTGCCCCTTCAGGC
AATGAGCTGAGCAATGGTGGCCGCATCTCCATGCGTAAAACCGGGAGCAA
GTCTGTTTCTTCAGGTAGCCCGTGGTACGGCCCGGACAGAGTCAAGTACT
TGGGCCCACTCTCTGGCGAGCCCCCAAGCTACTTGACTGGTGAGTTCCCT
GGTGACTACGGTTGGGACACTGCTGGGCTTTCAGCTGACCCAGAAACCTT
TGCCAAGAACCGTGAACTCGAAGTCATCCACTGCAGATGGGCCATGTTGG
GAGCTCTTGGATGCGTCTTCCCGGAGCTCTTGGCCCGCAACGGAGTCAAG
TTCGGTGAGGCCGTGTGGTTCAAGGCGGGGGCCCAGATCTTCAGCGAGGG
CGGGCTTGACTACTTGGGGAACCCAAGCCTGATCCACGCTCAGAGCATCT
TGGCCATCTGGGCTTGCCAGGTGGTCTTGATGGGAGCCGTTGAGGGTTAC
AGAATTGCTGGAGGGCCGCTCGGTGAAGTGACTGACCCATTGTACCCAGG
TGGCAGCTTTGATCCATTGGGTTTGGCTGATGACCCGGAGGCTTTTGCTG
AGCTCAAGGGTAAGGAAATCAAGAATGGAAGGTTGGCTATGTTCTCCATG
TTTGGTTTCTTCGTTC
back to top