CAT01, CAT01 (genetic_marker) Citrus spp.

Marker Overview
NameCAT01
Genbank IDN/A
TypeSSR
SpeciesCitrus spp.
Repeat MotifCAT
Primer 1CAT01.Forward Primer: GCTTCGATCCCTCCACATA
Primer 2CAT01.Reverse Primer: GATCCCTACAATCCTTGGTCC
Publication[view all]
ContactYong-Sham Kwon
Noelle Barkley
Sergio Ferrante
MJ Asins
Contact
NameDetails
Yong-Sham Kwon
First name:Yong-Sham
Last name:Kwon
Title:Researcher
Institution:Dong-A University
Address:Department of Genetic Engineering, College of Natural Resources and Life Science, Dong-A University, Busan 49315, Korea
Country:Korea
Email:yskwon3@dau.ac.kr
Noelle Barkley
First name:Noelle
Last name:Barkley
Title:Researcher
Institution:University of California, Riverside
Address:Department of Botany and Plant Sciences and Graduate Program in Genetics, Genomics, and Bioinformatics, University of California, Riverside, USA
Country:USA
Email:nbarkley@ars-grin.gov
Phone:+1-770-4124035
Fax:+ 1-770-2293323
Sergio Ferrante
First name:Sergio
Last name:Ferrante
Title:Researcher
Institution:Institute of Plant Genetics (Research Division of Palermo)
Address:CNR—Institute of Plant Genetics (Research Division of Palermo), Corso Calatafimi 414, 90129 Palermo, Italy
Country:Italy
Email:sergiopietro.ferrante@igv.cnr.it
MJ Asins
First name:MJ
Last name:Asins
Title:Researcher
Institution:IVIA
Address:Instituto Valenciano de Investigaciones Agrarias (IVIA), Apartado Oficial, 46113 Moncada (Valencia), Spain
Country:Spain
Email:mjasins@ivia.es
Fax:+34-961390240
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerCAT01.Forward PrimerCitrus spp.primer
Reverse PrimerCAT01.Reverse PrimerCitrus spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CAT01, 140CAT01, 140Citrus spp.marker_locus
CAT01,140CAT01,140Citrus spp.marker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Poncirus-Rich/FlyingDragon-F1-2012Pr4bN/A81CAT01, 140View
2Citrus-Cleopatra/FlyingDragon-Cleopatra-F1-2012R4bN/A93CAT01, 140View
3Citrus-Cleopatra/Trifoliatesp-F2-2012RPr4bN/A62CAT01, 140View
4Citrus-Cleopatra/P.trifoliata-Cleopatra-F1-2016r4bN/A119.3CAT01,140View
5Citrus-Cleopatra/P.trifoliata-P.trifoliata-F1-2016p4bN/A71.56CAT01,140View