AG14, AG14 (genetic_marker) Citrus spp.

Name	AG14
Genbank ID	N/A
Type	SSR
Species	Citrus spp.
Repeat Motif	AG
Primer 1	AG14.Forward Primer: AAAGGGAAAGCCCTAATCTCA
Primer 2	AG14.Reverse Primer: CTTCCTCTTGCGAGTGTTC
Publication	[view all]
Contact	Yong-Sham Kwon Noelle Barkley Behrouz Golein Osman Gulsen Qi-bin Hong

Name	Details
Yong-Sham Kwon	First name: Yong-Sham Last name: Kwon Title: Researcher Institution: Dong-A University Address: Department of Genetic Engineering, College of Natural Resources and Life Science, Dong-A University, Busan 49315, Korea Country: Korea Email: yskwon3@dau.ac.kr
Noelle Barkley	First name: Noelle Last name: Barkley Title: Researcher Institution: University of California, Riverside Address: Department of Botany and Plant Sciences and Graduate Program in Genetics, Genomics, and Bioinformatics, University of California, Riverside, USA Country: USA Email: nbarkley@ars-grin.gov Phone: +1-770-4124035 Fax: + 1-770-2293323
Behrouz Golein	First name: Behrouz Last name: Golein Title: Researcher Institution: Iran Citrus Research Institute Address: Department of Plant Breeding and Improvement, Iran Citrus Research Institute, Ramsar, Islamic Republic of Iran Country: Iran Email: bgoleincitrus@yahhoo.com Phone: +98 9113945261 Fax: +98 1925223282
Osman Gulsen	First name: Osman Last name: Gulsen Title: Researcher Institution: Erciyes University, Turkey Address: Erciyes University, Faculty of Agriculture, Department of Horticulture, 38039 Melikgazi, Kayseri, Turkey Country: Turkey Email: o_gulsen@yahoo.com Phone: +90 352 4374901 Fax: +90 352 4376902
Qi-bin Hong	First name: Qi-Bin Last name: Hong Title: Researcher Institution: Chinese Academy of Agricultural Sciences/Southwest University Address: Citrus Research Institute, Chinese Academy of Agricultural Sciences/Southwest University, National Citrus Engineering Research Center, Chongqing, P.R. China Country: China Email: hongqb@sina.com

This genetic_marker is adjacent to the following primer feature(s):

Feature Name	Unique Name	Species	Type
Forward Primer	AG14.Forward Primer	Citrus spp.	primer
Reverse Primer	AG14.Reverse Primer	Citrus spp.	primer

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature Name	Unique Name	Species	Type
SSRAG14.151	SSRAG14.151	Citrus spp.	marker_locus
AG14	AG14	Citrus spp.	marker_locus

Year	Publication
2016	Hong JH, Chae CW, Choi KJ, Kwon YS. A database of simple sequence repeats (SSR) marker based DNA profiles of Citrus and related cultivars and germplasm. Korean Journal of Horticultural Science and Technology. 2016; 34(1):142-153.
2006	Barkley N, Roose M, Krueger R, Federici C. Assessing genetic diversity and population structure in a citrus germplasm collection utilizing simple sequence repeat markers (SSRs). Theoretical and applied genetics. 2006; 112(8):1519-1531.
2012	Golein B, Bigonah M, Azadvar M, Golmohammadi M. Analysis of genetic relationship between 'Bakraee' (Citrus sp.) and some known Citrus genotypes through SSR and PCR-RFLP markers. Scientia horticulturae. 2012; 147-153.
2010	Gulsen O, Uzun A, Canan I, Seday U, Canihos E. A new citrus linkage map based on SRAP, SSR, ISSR, POGP, RGA and RAPD markers. Euphytica. 2010; 173(2):265-277.
2015	Hong Q, Ma X, Gong G, Peng Z, He Y. QTL mapping of citrus freeze tolerance. Acta horticulturae. 2015; (1065)467-474.

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Citrus-Orlando/Clementine-F1-Orlando-2010	Orl-1	N/A	73	SSRAG14.151	View
2	Citrus-Li2/Wan2-F1-2015	LG2	N/A	63.9	AG14	View