CiBE1644, CiBE1644 (genetic_marker) Citrus spp.

Marker Overview
NameCiBE1644
Genbank IDET097780
TypeSSR
SpeciesCitrus spp.
Repeat Motif(GTT)11
Primer 1CiBE1644.Forward Primer: ACAGAAGAGGAGCCATTATTT
Primer 2CiBE1644.Reverse Primer: CAGAGAGAACCCGAAGAAG
Publication[view all]
ContactYong-Sham Kwon
Patrick Ollitrault
Contact
NameDetails
Yong-Sham Kwon
First name:Yong-Sham
Last name:Kwon
Title:Researcher
Institution:Dong-A University
Address:Department of Genetic Engineering, College of Natural Resources and Life Science, Dong-A University, Busan 49315, Korea
Country:Korea
Email:yskwon3@dau.ac.kr
Patrick Ollitrault
First name:Patrick
Last name:Ollitrault
Title:Researcher
Institution:CIRAD
Address:Unite de Recherche Multiplication Vegetative, Centre de Cooperation Internationale en Recherche Agronomique pour le Developpement (CIRAD), Montpellier 34398, France
Country:France
Email:patrick.ollitrault@cirad.fr
Phone:+33(0)467615971
Fax:+33(0)467615666
Last update:Jun 2020
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerCiBE1644.Forward PrimerCitrus spp.primer
Reverse PrimerCiBE1644.Reverse PrimerCitrus spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CiBE1644CiBE1644Citrus spp.marker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Citrus-Clementine-Ref-F1LG3N/A70.2CiBE1644View
2Citrus-Clementine-Ref-Female-F13N/A32.2CiBE1644View
3Citrus-Clementine-Ref-Male-F13N/A82.63CiBE1644View
4Poncirus/Citrus-SynthesisMap-Ref-F1LG3N/A70.2CiBE1644View