CiBE4825, CiBE4825 (genetic_marker) Citrus spp.

Marker Overview
NameCiBE4825
Genbank IDN/A
TypeSSR
SpeciesCitrus spp.
Repeat Motif(TTATT)4
Primer 1CiBE4825.Forward Primer: ATAAGTGGAAAGAGGTATCGG
Primer 2CiBE4825.Reverse Primer: GAACACCAAGCATCAAGAC
Publication[view all]
ContactYong-Sham Kwon
Contact
NameDetails
Yong-Sham Kwon
First name:Yong-Sham
Last name:Kwon
Title:Researcher
Institution:Dong-A University
Address:Department of Genetic Engineering, College of Natural Resources and Life Science, Dong-A University, Busan 49315, Korea
Country:Korea
Email:yskwon3@dau.ac.kr
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerCiBE4825.Forward PrimerCitrus spp.primer
Reverse PrimerCiBE4825.Reverse PrimerCitrus spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CiBE4825CiBE4825Citrus spp.marker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Citrus-Fina_Sodea/Byungkyool-F1-ByungkyoolB04N/A42CiBE4825View
2Citrus-Okitsu46/Okitsu56-F1LG08N/A19.2CiBE4825View