m908_s1, m908_s1 (genetic_marker) Citrus reticulata

Marker Overview
Namem908_s1
dbSNP IDN/A
TypeSNP
SNP AllelesA/C
SpeciesCitrus reticulata
Publication[view all]
ContactFrederick Gmitter
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
m908_s1m908_s1Citrus reticulatamarker_locus


Contact
NameDetails
Frederick Gmitter
First name:Frederick
Last name:Gmitter
Title:Researcher
Institution:University of Florida
Address:Citrus Research and Education Center, University of Florida, Lake Alfred, FL 33850, USA
Country:USA
Email:fgmitter@ufl.edu
Last update:Nov 2018
Sequence
>m908_s1 ID=m908_s1|Name=m908_s1|organism=Citrus reticulata|type=genetic_marker|length=242bp
CCTGCTGGCTGTCCAACATCAGCATTCTATGCTGTAGTCATCGATGATGA
CTTCTCCCAATGCAAAGAAGGGGTTAAAGTGATTACAAGCTCTATCCCCA
TGAAGCCTCGTCTGTTTGCCAMAGTGAAAAATGTAAATTACTTACCGAAT
GTCCTTGCAAAGATGGAAGCTGAAGATAAGGGAGCATCTGCTTCTATCTG
GATTGATGAGGACGGATATGTTGCTGAGGGTCCAAACGTGAA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Citrus-Fortune/Murcott-F1-20171N/A16655582m908_s1View
2Citrus-Fortune/Murcott-Fortune-F1-1991FOR1.1N/A11.8m908_s1View
3Citrus-Fortune/Murcott-Fortune-F1-2017FOR1.1N/A11.8m908_s1View