CAC23, CAC23 (genetic_marker) Citrus spp.

Marker Overview
NameCAC23
Genbank IDN/A
TypeSSR
SpeciesCitrus spp.
Repeat MotifCAC
Primer 1CAC23.Forward Primer: ATCACAATTACTAGCAGCGCC
Primer 2CAC23.Reverse Primer: TTGCCATTGTAGCATGTTGG
Publication[view all]
ContactA. Nematollahi
Behrouz Golein
MJ Asins
Osman Gulsen
M Thomas
Qi-bin Hong
Contact
NameDetails
A. Nematollahi
First name:A.
Last name:Nematollahi
Title:Researcher
Institution:College of Abouraihan
Address:Department of Horticulture, College of Abouraihan, University of Tehran, Tehran, Iran
Country:Iran
Behrouz Golein
First name:Behrouz
Last name:Golein
Title:Researcher
Institution:Iran Citrus Research Institute
Address:Department of Plant Breeding and Improvement, Iran Citrus Research Institute, Ramsar, Islamic Republic of Iran
Country:Iran
Email:bgoleincitrus@yahhoo.com
Phone:+98 9113945261
Fax:+98 1925223282
MJ Asins
First name:MJ
Last name:Asins
Title:Researcher
Institution:IVIA
Address:Instituto Valenciano de Investigaciones Agrarias (IVIA), Apartado Oficial, 46113 Moncada (Valencia), Spain
Country:Spain
Email:mjasins@ivia.es
Fax:+34-961390240
Osman Gulsen
First name:Osman
Last name:Gulsen
Title:Researcher
Institution:Erciyes University, Turkey
Address:Erciyes University, Faculty of Agriculture, Department of Horticulture, 38039 Melikgazi, Kayseri, Turkey
Country:Turkey
Email:o_gulsen@yahoo.com
Phone:+90 352 4374901
Fax:+90 352 4376902
M Thomas
First name:M
Last name:Thomas
Institution:CSIRO
Address:CSIRO, Division of Horticulture, GPO Box 350, Adelaide, S.A 5001, Australia
Qi-bin Hong
First name:Qi-Bin
Last name:Hong
Title:Researcher
Institution:Chinese Academy of Agricultural Sciences/Southwest University
Address:Citrus Research Institute, Chinese Academy of Agricultural Sciences/Southwest University, National Citrus Engineering Research Center, Chongqing, P.R. China
Country:China
Email:hongqb@sina.com
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerCAC23.Forward PrimerCitrus spp.primer
Reverse PrimerCAC23.Reverse PrimerCitrus spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CAC23CAC23Citrus spp.marker_locus
SSRCAC23.500SSRCAC23.500Citrus spp.marker_locus
CAC23, 230CAC23, 230Citrus spp.marker_locus
CAC23,230CAC23,230Citrus spp.marker_locus


Publications
YearPublication
2009Khadem Nematollahi A, Vahdati K, Nabipour A, Golein B, Danesh M. Assessment of genetic variation in citrus germplasm of South of Iran using SSR markers. Acta horticulturae. 2009; (839)549-554.
2012Golein B, Bigonah M, Azadvar M, Golmohammadi M. Analysis of genetic relationship between 'Bakraee' (Citrus sp.) and some known Citrus genotypes through SSR and PCR-RFLP markers. Scientia horticulturae. 2012; 147-153.
2012Raga V, Bernet GP, Carbonell EA, Asíns MJ. Segregation and linkage analyses in two complex populations derived from the citrus rootstock Cleopatra mandarin. Inheritance of seed reproductive traits. Tree Genetics and Genomes. 2012; 8(5):1061-1071.
2010Gulsen O, Uzun A, Canan I, Seday U, Canihos E. A new citrus linkage map based on SRAP, SSR, ISSR, POGP, RGA and RAPD markers. Euphytica. 2010; 173(2):265-277.
1997Kijas J, Thomas M, Fowler J, Roose M. Integration of trinucleotide microsatellites into a linkage map of Citrus. Theoretical and applied genetics. 1997 Apr; 94(5):701-706.
2015Hong Q, Ma X, Gong G, Peng Z, He Y. QTL mapping of citrus freeze tolerance. Acta horticulturae. 2015; (1065)467-474.
2016Raga V, Intrigliolo DS, Bernet GP, Carbonell EA, Asins MJ. Genetic analysis of salt tolerance in a progeny derived from the citrus rootstocks Cleopatra mandarin and trifoliate orange. Tree Genetics & Genomes. 2016; 12:34.
2003Ruiz C, Asins M. Comparison between Poncirus and Citrus genetic linkage maps. Theoretical and applied genetics. 2003 Mar; 106(5):826-836.
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Citrus-AfinVerna/FlyingDragon-AfinVerna-F1-2002A10Magnesium concentration3.5CAC23View
2Citrus-AfinVerna/FlyingDragon-AfinVerna-F1-2002A10Vanadium concentration3.5CAC23View
3Citrus-Volkamer/Rubidoux-Volkamer-F1-2003V IMagnesium concentration8.6CAC23View
4Citrus-Volkamer/Rubidoux-Volkamer-F1-2003V IVanadium concentration8.6CAC23View
5Citrus-Volkamer/Rubidoux-Volkamer-F1-1996V7Magnesium concentration6CAC23View
6Citrus-Volkamer/Rubidoux-Volkamer-F1-1996V7Vanadium concentration6CAC23View
7Citrus-Orlando/Clementine-F1-Orlando-2010Orl-9N/A20SSRCAC23.500View
8Citrus-AfinVerna/FlyingDragon-AfinVerna-F1-2003A 10Magnesium concentration17CAC23View
9Citrus-AfinVerna/FlyingDragon-AfinVerna-F1-2003A 10Vanadium concentration17CAC23View
10Citrus-Cleopatra/FlyingDragon-Cleopatra-F1-2012R7N/A153CAC23, 230View
11Citrus-Cleopatra/Trifoliatesp-F2-2012RPr7bN/A0CAC23, 230View
12Citrus-Sacaton/Troyer-RIL-1997FMagnesium concentration39CAC23View
13Citrus-Sacaton/Troyer-RIL-1997FVanadium concentration39CAC23View
14Citrus-Li2/Wan2-F1-2015LG3Magnesium concentration46.1CAC23View
15Citrus-Li2/Wan2-F1-2015LG3Vanadium concentration46.1CAC23View
16Citrus-Cleopatra/P.trifoliata-Cleopatra-F1-2016r7N/A199.12CAC23,230View