TAA27, TAA27 (genetic_marker) Citrus spp.

Marker Overview
NameTAA27
Genbank IDN/A
TypeSSR
SpeciesCitrus spp.
Primer 1TAA27.Forward Primer: GGATGAAAAATGCTCAAAATG
Primer 2TAA27.Reverse Primer: TAGTACCCACAGGGAAGAGAGC
Publication[view all]
ContactBehrouz Golein
MJ Asins
M Thomas
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerTAA27.Forward PrimerCitrus spp.primer
Reverse PrimerTAA27.Reverse PrimerCitrus spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TAA27TAA27Citrus spp.marker_locus
TAA27,235TAA27,235Citrus spp.marker_locus
TAA27, 235TAA27, 235Citrus spp.marker_locus


Contact
NameDetails
Behrouz Golein
First name:Behrouz
Last name:Golein
Title:Researcher
Institution:Iran Citrus Research Institute
Address:Department of Plant Breeding and Improvement, Iran Citrus Research Institute, Ramsar, Islamic Republic of Iran
Country:Iran
Email:bgoleincitrus@yahhoo.com
Phone:+98 9113945261
Fax:+98 1925223282
MJ Asins
First name:MJ
Last name:Asins
Title:Researcher
Institution:IVIA
Address:Instituto Valenciano de Investigaciones Agrarias (IVIA), Apartado Oficial, 46113 Moncada (Valencia), Spain
Country:Spain
Email:mjasins@ivia.es
Fax:+34-961390240
M Thomas
First name:M
Last name:Thomas
Institution:CSIRO
Address:CSIRO, Division of Horticulture, GPO Box 350, Adelaide, S.A 5001, Australia
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Poncirus-FlyingDragon/FlyingDragon-RIL-2003Pp3Duration of juvenility period1TAA27View
2Poncirus-FlyingDragon/FlyingDragon-RIL-2003Pp3Sulfur concentration1TAA27View
3Citrus-AfinVerna/FlyingDragon-AfinVerna-F1-2002A3Duration of juvenility period7.7TAA27View
4Citrus-AfinVerna/FlyingDragon-AfinVerna-F1-2002A3Sulfur concentration7.7TAA27View
5Citrus-Volkamer/Rubidoux-Volkamer-F1-2003Pv 3Duration of juvenility period4.2TAA27View
6Citrus-Volkamer/Rubidoux-Volkamer-F1-2003Pv 3Sulfur concentration4.2TAA27View
7Citrus-Volkamer/Rubidoux-Volkamer-F1-2003V IIDuration of juvenility period6.3TAA27View
8Citrus-Volkamer/Rubidoux-Volkamer-F1-2003V IISulfur concentration6.3TAA27View
9Citrus-Volkamer/Rubidioux-Rubidoux-F1-1999P5Duration of juvenility period9.9TAA27View
10Citrus-Volkamer/Rubidioux-Rubidoux-F1-1999P5Sulfur concentration9.9TAA27View
11Citrus-Volkamer/Rubidoux-Volkamer-F1-1996V5Duration of juvenility period6.7TAA27View
12Citrus-Volkamer/Rubidoux-Volkamer-F1-1996V5Sulfur concentration6.7TAA27View
13Citrus-Volkamer/Rubidoux-F1-1996P5/V5Duration of juvenility period0TAA27View
14Citrus-Volkamer/Rubidoux-F1-1996P5/V5Sulfur concentration0TAA27View
15Citrus-AfinVerna/FlyingDragon-AfinVerna-F1-2003A 3Duration of juvenility period29TAA27View
16Citrus-AfinVerna/FlyingDragon-AfinVerna-F1-2003A 3Sulfur concentration29TAA27View
17Poncirus-Rich/FlyingDragon-F1-2012Pr3bN/A33TAA27,235View
18Citrus-Cleopatra/FlyingDragon-Cleopatra-F1-2012R3N/A65TAA27, 235View
19Citrus-Cleopatra/Trifoliatesp-F2-2012RPr3bN/A18TAA27, 235View
20Citrus-Sacaton/Troyer-RIL-1997DDuration of juvenility period74TAA27View
21Citrus-Sacaton/Troyer-RIL-1997DSulfur concentration74TAA27View
22Citrus_FlyingDragon/FlyingDragon-RIL-2003Pp3Duration of juvenility period2TAA27View
23Citrus_FlyingDragon/FlyingDragon-RIL-2003Pp3Sulfur concentration2TAA27View
24Citrus-Cleopatra/P.trifoliata-Cleopatra-F1-2016r3N/A85.16TAA27,235View
25Citrus-Cleopatra/P.trifoliata-P.trifoliata-F1-2016p3bN/A39.9TAA27,235View