TAA41, TAA41 (genetic_marker) Citrus spp.

Marker Overview
NameTAA41
Genbank IDN/A
TypeSSR
SpeciesCitrus spp.
Repeat MotifTAA
Primer 1TAA41.Forward Primer: AGGTCTACATTGGCATTGTC
Primer 2TAA41.Reverse Primer: ACATGCAGTGCTATAATGAATG
Publication[view all]
ContactSergio Ferrante
Behrouz Golein
X.X. Deng
MJ Asins
M Thomas
Qi-bin Hong
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerTAA41.Forward PrimerCitrus spp.primer
Reverse PrimerTAA41.Reverse PrimerCitrus spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TAA41TAA41Citrus spp.marker_locus
SSRTAA41.145SSRTAA41.145Citrus spp.marker_locus
TAA41, 16TAA41, 16Citrus spp.marker_locus
TAA41, 160TAA41, 160Citrus spp.marker_locus
TAA41,160TAA41,160Citrus spp.marker_locus


Contact
NameDetails
Sergio Ferrante
First name:Sergio
Last name:Ferrante
Title:Researcher
Institution:Institute of Plant Genetics (Research Division of Palermo)
Address:CNR—Institute of Plant Genetics (Research Division of Palermo), Corso Calatafimi 414, 90129 Palermo, Italy
Country:Italy
Email:sergiopietro.ferrante@igv.cnr.it
Behrouz Golein
First name:Behrouz
Last name:Golein
Title:Researcher
Institution:Iran Citrus Research Institute
Address:Department of Plant Breeding and Improvement, Iran Citrus Research Institute, Ramsar, Islamic Republic of Iran
Country:Iran
Email:bgoleincitrus@yahhoo.com
Phone:+98 9113945261
Fax:+98 1925223282
X.X. Deng
First name:X.X.
Last name:Deng
Title:Researcher
Institution:Huazhong Agricultural University
Address:National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan 430070, P.R. China
Country:China
Email:dxxwwlj@public.wh.hb.cn
MJ Asins
First name:MJ
Last name:Asins
Title:Researcher
Institution:IVIA
Address:Instituto Valenciano de Investigaciones Agrarias (IVIA), Apartado Oficial, 46113 Moncada (Valencia), Spain
Country:Spain
Email:mjasins@ivia.es
Fax:+34-961390240
M Thomas
First name:M
Last name:Thomas
Institution:CSIRO
Address:CSIRO, Division of Horticulture, GPO Box 350, Adelaide, S.A 5001, Australia
Qi-bin Hong
First name:Qi-Bin
Last name:Hong
Title:Researcher
Institution:Chinese Academy of Agricultural Sciences/Southwest University
Address:Citrus Research Institute, Chinese Academy of Agricultural Sciences/Southwest University, National Citrus Engineering Research Center, Chongqing, P.R. China
Country:China
Email:hongqb@sina.com
Publications
YearPublication
2010Ferrante SP, Lucretti S, Reale S, De Patrizio A, Abbate L, Tusa N, Scarano M. Assessment of the origin of new citrus tetraploid hybrids (2n = 4x) by means of SSR markers and PCR based dosage effects. Euphytica. 2010; 173(2):223-233.
2012Golein B, Bigonah M, Azadvar M, Golmohammadi M. Analysis of genetic relationship between 'Bakraee' (Citrus sp.) and some known Citrus genotypes through SSR and PCR-RFLP markers. Scientia horticulturae. 2012; 147-153.
2002Liu J, Pang X, Cheng Y, Meng H, Deng X. Molecular characterization of the nuclear and cytoplasmic genomes of intergeneric diploid plants from cell fusion between Microcitrus papuana and Rough lemon. Plant cell reports. 2002 Nov; 21(4):327-332.
2012Raga V, Bernet GP, Carbonell EA, Asíns MJ. Segregation and linkage analyses in two complex populations derived from the citrus rootstock Cleopatra mandarin. Inheritance of seed reproductive traits. Tree Genetics and Genomes. 2012; 8(5):1061-1071.
1997Kijas J, Thomas M, Fowler J, Roose M. Integration of trinucleotide microsatellites into a linkage map of Citrus. Theoretical and applied genetics. 1997 Apr; 94(5):701-706.
2015Hong Q, Ma X, Gong G, Peng Z, He Y. QTL mapping of citrus freeze tolerance. Acta horticulturae. 2015; (1065)467-474.
2016Raga V, Intrigliolo DS, Bernet GP, Carbonell EA, Asins MJ. Genetic analysis of salt tolerance in a progeny derived from the citrus rootstocks Cleopatra mandarin and trifoliate orange. Tree Genetics & Genomes. 2016; 12:34.
2003Ruiz C, Asins M. Comparison between Poncirus and Citrus genetic linkage maps. Theoretical and applied genetics. 2003 Mar; 106(5):826-836.
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Poncirus-FlyingDragon/FlyingDragon-RIL-2003Pp5bN/A5.9TAA41View
2Citrus-AfinVerna/FlyingDragon-AfinVerna-F1-2002Pa5abN/A78.4TAA41View
3Citrus-AfinVerna/FlyingDragon-AfinVerna-F1-2002A5bN/A0.6TAA41View
4Citrus-Volkamer/Rubidoux-Volkamer-F1-2003Pv5bN/A58.1TAA41View
5Citrus-Volkamer/Rubidoux-Volkamer-F1-2003V5bN/A17.8TAA41View
6Citrus-Volkamer/Rubidoux-Volkamer-F1-1996V6N/A0TAA41View
7Citrus-Orlando/Clementine-F1-Orlando-2010Orl-1N/A153SSRTAA41.145View
8Poncirus-Rich/FlyingDragon-F1-2012Pr10+5bN/A11TAA41, 16View
9Citrus-Cleopatra/FlyingDragon-Cleopatra-F1-2012R10+5bN/A0TAA41, 160View
10Poncirus-Rich/FlyingDragon-F1-2012Pr10+5bN/A11TAA41, 160View
11Citrus-Cleopatra/FlyingDragon-FlyingDragon-F1-2012Rf10+5bN/A4TAA41, 160View
12Citrus-Cleopatra/Rich-Rich-F1-2012Rr10+5bN/A27TAA41, 160View
13Poncirus-FlyingDragon/FlyingDragon-F2-2000Prf10+5aN/A0TAA41, 160View
14Poncirus-Rich/Rich-F2-2000Prr10+5b(a)N/A26TAA41, 160View
15Citrus-Li2/Wan2-F1-2015LG2N/A26.7TAA41View
16Citrus-Cleopatra/P.trifoliata-Cleopatra-F1-2016r10+5bN/A33.32TAA41,160View
17Citrus-Cleopatra/P.trifoliata-P.trifoliata-F1-2016p10+5bN/A19.1TAA41,160View