TAA52, TAA52 (genetic_marker) Citrus spp.

Marker Overview
NameTAA52
Genbank IDN/A
TypeSSR
SpeciesCitrus spp.
Repeat MotifTAA
Primer 1TAA52.Forward Primer: GATCTTGACTGAACTTAAAG
Primer 2TAA52.Reverse Primer: ATGTATTGTGTTGATAACG
Publication[view all]
ContactA. Nematollahi
Behrouz Golein
X.X. Deng
MJ Asins
M Thomas
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerTAA52.Forward PrimerCitrus spp.primer
Reverse PrimerTAA52.Reverse PrimerCitrus spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TAA52TAA52Citrus spp.marker_locus
TAA52, 120TAA52, 120Citrus spp.marker_locus
TAA52,100TAA52,100Citrus spp.marker_locus
TAA52,120TAA52,120Citrus spp.marker_locus


Contact
NameDetails
A. Nematollahi
First name:A.
Last name:Nematollahi
Title:Researcher
Institution:College of Abouraihan
Address:Department of Horticulture, College of Abouraihan, University of Tehran, Tehran, Iran
Country:Iran
Behrouz Golein
First name:Behrouz
Last name:Golein
Title:Researcher
Institution:Iran Citrus Research Institute
Address:Department of Plant Breeding and Improvement, Iran Citrus Research Institute, Ramsar, Islamic Republic of Iran
Country:Iran
Email:bgoleincitrus@yahhoo.com
Phone:+98 9113945261
Fax:+98 1925223282
X.X. Deng
First name:X.X.
Last name:Deng
Title:Researcher
Institution:Huazhong Agricultural University
Address:National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan 430070, P.R. China
Country:China
Email:dxxwwlj@public.wh.hb.cn
MJ Asins
First name:MJ
Last name:Asins
Title:Researcher
Institution:IVIA
Address:Instituto Valenciano de Investigaciones Agrarias (IVIA), Apartado Oficial, 46113 Moncada (Valencia), Spain
Country:Spain
Email:mjasins@ivia.es
Fax:+34-961390240
M Thomas
First name:M
Last name:Thomas
Institution:CSIRO
Address:CSIRO, Division of Horticulture, GPO Box 350, Adelaide, S.A 5001, Australia
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Citrus-AfinVerna/FlyingDragon-AfinVerna-F1-2002A8Strontium concentration17.9TAA52View
2Citrus-Volkamer/Rubidoux-Volkamer-F1-2003Pv8Strontium concentration0TAA52View
3Citrus-Volkamer/Rubidoux-Volkamer-F1-2003V8Strontium concentration53.6TAA52View
4Citrus-Volkamer/Rubidioux-Rubidoux-F1-1999P1Strontium concentration0TAA52View
5Citrus-Volkamer/Rubidoux-Volkamer-F1-1996V1Strontium concentration7.1TAA52View
6Citrus-Volkamer/Rubidoux-F1-1996P1/V1Strontium concentration9.4TAA52View
7Citrus-AfinVerna/FlyingDragon-AfinVerna-F1-2003A 8Strontium concentration17TAA52View
8Citrus-Cleopatra/FlyingDragon-Cleopatra-F1-2012R8+6N/A33TAA52, 120View
9Citrus-Cleopatra/Trifoliatesp-F2-2012RPr8+6N/A0TAA52,100View
10Citrus-Sacaton/Troyer-RIL-1997AStrontium concentration0TAA52View
11Citrus-Cleopatra/P.trifoliata-Cleopatra-F1-2016r8+6N/A49.83TAA52,120View