ATC09, ATC09 (genetic_marker) Citrus spp.

Marker Overview
NameATC09
Genbank IDN/A
TypeSSR
SpeciesCitrus spp.
Repeat MotifTCA
Primer 1ATC09.Forward Primer: TTCCTTATGTAATTGCTCTTTG
Primer 2ATC09.Reverse Primer: TGTGAGTGTTTGTGCGTGTG
Publication[view all]
ContactNoelle Barkley
MJ Asins
Osman Gulsen
Contact
NameDetails
Noelle Barkley
First name:Noelle
Last name:Barkley
Title:Researcher
Institution:University of California, Riverside
Address:Department of Botany and Plant Sciences and Graduate Program in Genetics, Genomics, and Bioinformatics, University of California, Riverside, USA
Country:USA
Email:nbarkley@ars-grin.gov
Phone:+1-770-4124035
Fax:+ 1-770-2293323
MJ Asins
First name:MJ
Last name:Asins
Title:Researcher
Institution:IVIA
Address:Instituto Valenciano de Investigaciones Agrarias (IVIA), Apartado Oficial, 46113 Moncada (Valencia), Spain
Country:Spain
Email:mjasins@ivia.es
Fax:+34-961390240
Osman Gulsen
First name:Osman
Last name:Gulsen
Title:Researcher
Institution:Erciyes University, Turkey
Address:Erciyes University, Faculty of Agriculture, Department of Horticulture, 38039 Melikgazi, Kayseri, Turkey
Country:Turkey
Email:o_gulsen@yahoo.com
Phone:+90 352 4374901
Fax:+90 352 4376902
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerATC09.Forward PrimerCitrus spp.primer
Reverse PrimerATC09.Reverse PrimerCitrus spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SSRATC09.100SSRATC09.100Citrus spp.marker_locus
ATC09, 190ATC09, 190Citrus spp.marker_locus
ATC09, 180ATC09, 180Citrus spp.marker_locus
ATC09,190ATC09,190Citrus spp.marker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Citrus-Orlando/Clementine-F1-Orlando-2010Orl-5N/A68SSRATC09.100View
2Citrus-Cleopatra/FlyingDragon-Cleopatra-F1-2012R4bN/A78ATC09, 190View
3Citrus-Cleopatra/Trifoliatesp-F2-2012RPr4bN/A34ATC09, 180View
4Citrus-Cleopatra/P.trifoliata-Cleopatra-F1-2016r4bN/A101.38ATC09,190View