CiBE3445, CiBE3445 (genetic_marker) Citrus clementina

Marker Overview
NameCiBE3445
Genbank IDET073043
TypeSSR
SpeciesCitrus clementina
Repeat Motif(ATAA)3
Primer 1CiBE3445.Forward Primer: CGTAATCAATGTGTCAGCAA
Primer 2CiBE3445.Reverse Primer: TTCCAAGCAAAGAGAACAA
Product Length210
Publication[view all]
ContactPatrick Ollitrault
Contact
NameDetails
Patrick Ollitrault
First name:Patrick
Last name:Ollitrault
Title:Researcher
Institution:CIRAD
Address:Unite de Recherche Multiplication Vegetative, Centre de Cooperation Internationale en Recherche Agronomique pour le Developpement (CIRAD), Montpellier 34398, France
Country:France
Email:patrick.ollitrault@cirad.fr
Phone:+33(0)467615971
Fax:+33(0)467615666
Last update:Jun 2020
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerCiBE3445.Forward PrimerCitrus clementinaprimer
Reverse PrimerCiBE3445.Reverse PrimerCitrus clementinaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CiBE3445CiBE3445Citrus clementinamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Citrus-Clementine-Ref-F1LG1N/A87.3CiBE3445View
2Citrus-Clementine-Ref-Female-F11N/A65.48CiBE3445View
3Citrus-Clementine-Ref-Male-F11N/A85.84CiBE3445View
4Poncirus/Citrus-SynthesisMap-Ref-F1LG1N/A87.3CiBE3445View