CiBE6147, CiBE6147 (genetic_marker) Citrus clementina

Marker Overview
Genbank IDET085226
SpeciesCitrus clementina
Repeat Motif(CT)15
Primer 1CiBE6147.Forward Primer: GCCTGTGGTTCATCTCTATCT
Primer 2CiBE6147.Reverse Primer: AAGTGGGATTTGGTGATTT
Product Length212
Publication[view all]
ContactPatrick Ollitrault
Patrick Ollitrault
First name:Patrick
Last name:Ollitrault
Address:Unite de Recherche Multiplication Vegetative, Centre de Cooperation Internationale en Recherche Agronomique pour le Developpement (CIRAD), Montpellier 34398, France
Last update:Jun 2020

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerCiBE6147.Forward PrimerCitrus clementinaprimer
Reverse PrimerCiBE6147.Reverse PrimerCitrus clementinaprimer

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CiBE6147CiBE6147Citrus clementinamarker_locus

Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer