CiC3546-04, CiC3546-04 (genetic_marker) Citrus clementina

Marker Overview
NameCiC3546-04
dbSNP IDN/A
TypeSNP
SNP Alleles[T/C]
SpeciesCitrus clementina
Publication[view all]
ContactPatrick Ollitrault
Contact
NameDetails
Patrick Ollitrault
First name:Patrick
Last name:Ollitrault
Title:Researcher
Institution:CIRAD
Address:Unite de Recherche Multiplication Vegetative, Centre de Cooperation Internationale en Recherche Agronomique pour le Developpement (CIRAD), Montpellier 34398, France
Country:France
Email:patrick.ollitrault@cirad.fr
Phone:+33(0)467615971
Fax:+33(0)467615666
Last update:Jun 2020
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CiC3546-04CiC3546-04Citrus clementinamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Citrus-Clementine-Ref-Female-F14N/A16.8CiC3546-04View
2Citrus-Clementine-Ref-Male-F14N/A69.38CiC3546-04View
Sequence
>CiC3546-04 ID=CiC3546-04|Name=CiC3546-04|organism=Citrus clementina|type=genetic_marker|length=121bp
AGACACCTTTAGAGACAAAAGACCATCAAGATGTGAAACAAAATCTCCAC
TGCCAGATGGRCCAAAAGCCTCCCAGAACCGAAGAGTCTCATCCGCAGCA
GCTGAYACCACAGTTAGGCCA