CID0599, CID0599 (genetic_marker) Citrus clementina

Marker Overview
Genbank IDET093125.1
SpeciesCitrus clementina
Primer 1CID0599.Forward Primer: CATTGCAGGAAACGGCTGTG
Product Length330
Publication[view all]
ContactPatrick Ollitrault
Patrick Ollitrault
First name:Patrick
Last name:Ollitrault
Address:Unite de Recherche Multiplication Vegetative, Centre de Cooperation Internationale en Recherche Agronomique pour le Developpement (CIRAD), Montpellier 34398, France
Last update:Jun 2020

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerCID0599.Forward PrimerCitrus clementinaprimer
Reverse PrimerCID0599.Reverse PrimerCitrus clementinaprimer

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CID0599CID0599Citrus clementinamarker_locus

Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer