CID6314, CID6314 (genetic_marker) Citrus clementina

Marker Overview
NameCID6314
Genbank IDET085526.1
TypeIndel
SpeciesCitrus clementina
Primer 1CID6314.Forward Primer: CCCCAACAACATGGAAACCG
Primer 2CID6314.Reverse Primer: TGTCCCCAACTTTCTTGGTGC
Product Length239
Publication[view all]
ContactPatrick Ollitrault
Contact
NameDetails
Patrick Ollitrault
First name:Patrick
Last name:Ollitrault
Title:Researcher
Institution:CIRAD
Address:Unite de Recherche Multiplication Vegetative, Centre de Cooperation Internationale en Recherche Agronomique pour le Developpement (CIRAD), Montpellier 34398, France
Country:France
Email:patrick.ollitrault@cirad.fr
Phone:+33(0)467615971
Fax:+33(0)467615666
Last update:Jun 2020
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerCID6314.Forward PrimerCitrus clementinaprimer
Reverse PrimerCID6314.Reverse PrimerCitrus clementinaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CID6314CID6314Citrus clementinamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Citrus-Clementine-Ref-F1LG3N/A65.7CID6314View
2Citrus-Clementine-Ref-Female-F13N/A31.89CID6314View
3Citrus-Clementine-Ref-Male-F13N/A74.13CID6314View
4Poncirus/Citrus-SynthesisMap-Ref-F1LG3N/A65.7CID6314View