CMS-30, CMS-30 (genetic_marker) Citrus spp.

Marker Overview
NameCMS-30
Genbank IDN/A
TypeSSR
SpeciesCitrus spp.
Repeat Motif(CT)9(CA)5
Primer 1CMS-30.Forward Primer: AACACCCCTTGGAGGGAG
Primer 2CMS-30.Reverse Primer: GCTGTTCACACACACAACCC
Publication[view all]
ContactStephen Southwick
Contact
NameDetails
Stephen Southwick
First name:Stephen
Last name:Southwick
Institution:UC-Davis
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerCMS-30.Forward PrimerCitrus spp.primer
Reverse PrimerCMS-30.Reverse PrimerCitrus spp.primer