CMS-6, CMS-6 (genetic_marker) Citrus spp.

Marker Overview
NameCMS-6
Genbank IDN/A
TypeSSR
SpeciesCitrus spp.
Repeat Motif(AT)14
Primer 1CMS-6.Forward Primer: TATGGGCTAGCGCCGTAG
Primer 2CMS-6.Reverse Primer: TCCTCGTCTTTGGGTCGTAC
Publication[view all]
ContactStephen Southwick
Contact
NameDetails
Stephen Southwick
First name:Stephen
Last name:Southwick
Institution:UC-Davis
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerCMS-6.Forward PrimerCitrus spp.primer
Reverse PrimerCMS-6.Reverse PrimerCitrus spp.primer