CMS-7, CMS-7 (genetic_marker) Citrus spp.

Marker Overview
NameCMS-7
Genbank IDN/A
TypeSSR
SpeciesCitrus spp.
Repeat Motif(CT)16
Primer 1CMS-7.Forward Primer: CAGGATGCTTGTTGGTGATG
Primer 2CMS-7.Reverse Primer: ACAGTGGATACAAACATGCTGC
Publication[view all]
ContactStephen Southwick
Contact
NameDetails
Stephen Southwick
First name:Stephen
Last name:Southwick
Institution:UC-Davis
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerCMS-7.Forward PrimerCitrus spp.primer
Reverse PrimerCMS-7.Reverse PrimerCitrus spp.primer