CT19, CT19 (genetic_marker) Citrus spp.

Marker Overview
NameCT19
Genbank IDN/A
TypeSSR
SpeciesCitrus spp.
Repeat MotifTC
Primer 1CT19.Forward Primer: CGCCAAGCTTACCACTCACTAC
Primer 2CT19.Reverse Primer: GCCACGATTTGTAGGGGATAG
Publication[view all]
ContactNoelle Barkley
Behrouz Golein
Osman Gulsen
MJ Asins
Qi-bin Hong
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerCT19.Forward PrimerCitrus spp.primer
Reverse PrimerCT19.Reverse PrimerCitrus spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SSRCT19.171SSRCT19.171Citrus spp.marker_locus
CT19, 165CT19, 165Citrus spp.marker_locus
CT19CT19Citrus spp.marker_locus
CT19,165CT19,165Citrus spp.marker_locus


Contact
NameDetails
Noelle Barkley
First name:Noelle
Last name:Barkley
Title:Researcher
Institution:University of California, Riverside
Address:Department of Botany and Plant Sciences and Graduate Program in Genetics, Genomics, and Bioinformatics, University of California, Riverside, USA
Country:USA
Email:nbarkley@ars-grin.gov
Phone:+1-770-4124035
Fax:+ 1-770-2293323
Behrouz Golein
First name:Behrouz
Last name:Golein
Title:Researcher
Institution:Iran Citrus Research Institute
Address:Department of Plant Breeding and Improvement, Iran Citrus Research Institute, Ramsar, Islamic Republic of Iran
Country:Iran
Email:bgoleincitrus@yahhoo.com
Phone:+98 9113945261
Fax:+98 1925223282
Osman Gulsen
First name:Osman
Last name:Gulsen
Title:Researcher
Institution:Erciyes University, Turkey
Address:Erciyes University, Faculty of Agriculture, Department of Horticulture, 38039 Melikgazi, Kayseri, Turkey
Country:Turkey
Email:o_gulsen@yahoo.com
Phone:+90 352 4374901
Fax:+90 352 4376902
MJ Asins
First name:MJ
Last name:Asins
Title:Researcher
Institution:IVIA
Address:Instituto Valenciano de Investigaciones Agrarias (IVIA), Apartado Oficial, 46113 Moncada (Valencia), Spain
Country:Spain
Email:mjasins@ivia.es
Fax:+34-961390240
Qi-bin Hong
First name:Qi-Bin
Last name:Hong
Title:Researcher
Institution:Chinese Academy of Agricultural Sciences/Southwest University
Address:Citrus Research Institute, Chinese Academy of Agricultural Sciences/Southwest University, National Citrus Engineering Research Center, Chongqing, P.R. China
Country:China
Email:hongqb@sina.com
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Citrus-Orlando/Clementine-F1-Clementine-2010Clem-5N/A35SSRCT19.171View
2Poncirus-Rich/FlyingDragon-F1-2012Pr10+5bN/A120CT19, 165View
3Citrus-Cleopatra/FlyingDragon-Cleopatra-F1-2012R10+5bN/A93CT19, 165View
4Citrus-Cleopatra/FlyingDragon-FlyingDragon-F1-2012Rf10+5bN/A25CT19, 165View
5Citrus-Cleopatra/Rich-Rich-F1-2012Rr10+5bN/A16CT19, 165View
6Poncirus-FlyingDragon/FlyingDragon-F2-2000Prf10+5bN/A0CT19, 165View
7Poncirus-Rich/Rich-F2-2000Prr10+5b(b)N/A6CT19, 165View
8Citrus-Li2/Wan2-F1-2015LG2N/A96.5CT19View
9Citrus-Cleopatra/P.trifoliata-Cleopatra-F1-2016r10+5bN/A113.81CT19,165View
10Citrus-Cleopatra/P.trifoliata-P.trifoliata-F1-2016p10+5bN/A150.1CT19,165View