F17, F17 (genetic_marker) Citrus spp.

Marker Overview
NameF17
Genbank IDCV710821
TypeSSR
SpeciesCitrus spp.
Primer 1F17.Forward Primer: GATACAAATTAGCATTTGATTGAATGGA
Primer 2F17.Reverse Primer: ATCGGGACTCGCATTAGGGT
Product Length116
Publication[view all]
ContactFred Gmitter
Qi-bin Hong
Contact
NameDetails
Fred Gmitter
First name:Fred
Last name:Gmitter
Title:Researcher
Institution:UFL
Address:Institute of Food and Agricultural Sciences,Citrus Research and Education Center, University of Florida, 700 Experiment Station Road, Lake Alfred, FL 33850, USA
Country:USA
Email:fgg@cred.ifas.ufl.edu
Phone:+ 1-863-9561151
Fax:+ 1-863-9564631
Last update:Feb 2007
Qi-bin Hong
First name:Qi-Bin
Last name:Hong
Title:Researcher
Institution:Chinese Academy of Agricultural Sciences/Southwest University
Address:Citrus Research Institute, Chinese Academy of Agricultural Sciences/Southwest University, National Citrus Engineering Research Center, Chongqing, P.R. China
Country:China
Email:hongqb@sina.com
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerF17.Forward PrimerCitrus spp.primer
Reverse PrimerF17.Reverse PrimerCitrus spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
F17F17Citrus spp.marker_locus
MarkerF17MarkerF17Citrus spp.marker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Citrus-Li2/Wan2-F1-2015LG8N/A42.7F17View
2Citrus-Clementine/Trifoliate-HAU21-F1-MaternalLG06N/A81.61MarkerF17View
3Citrus-Clementine/Trifoliate-HAU21-F1-PaternalLG06N/A172.23MarkerF17View