F21, F21 (genetic_marker) Citrus spp.

Marker Overview
NameF21
Genbank IDDN621499
TypeSSR
SpeciesCitrus spp.
Primer 1F21.Forward Primer: CTACAAGTTCCCCAGTTATCCCG
Primer 2F21.Reverse Primer: ACTTGACCCGCTCTAGGAGTGAC
Product Length140
Publication[view all]
ContactFred Gmitter
Contact
NameDetails
Fred Gmitter
First name:Fred
Last name:Gmitter
Title:Researcher
Institution:UFL
Address:Institute of Food and Agricultural Sciences,Citrus Research and Education Center, University of Florida, 700 Experiment Station Road, Lake Alfred, FL 33850, USA
Country:USA
Email:fgg@cred.ifas.ufl.edu
Phone:+ 1-863-9561151
Fax:+ 1-863-9564631
Last update:Feb 2007
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerF21.Forward PrimerCitrus spp.primer
Reverse PrimerF21.Reverse PrimerCitrus spp.primer