GT03, GT03 (genetic_marker) Citrus spp.

Marker Overview
NameGT03
Genbank IDN/A
TypeSSR
SpeciesCitrus spp.
Repeat MotifGT
Primer 1GT03.Forward Primer: GCCTTCTTGATTTACCGGAC
Primer 2GT03.Reverse Primer: TGCTCCGAACTTCATCATTG
Publication[view all]
ContactNoelle Barkley
Sergio Ferrante
Behrouz Golein
Osman Gulsen
MJ Asins
Qi-bin Hong
Contact
NameDetails
Noelle Barkley
First name:Noelle
Last name:Barkley
Title:Researcher
Institution:University of California, Riverside
Address:Department of Botany and Plant Sciences and Graduate Program in Genetics, Genomics, and Bioinformatics, University of California, Riverside, USA
Country:USA
Email:nbarkley@ars-grin.gov
Phone:+1-770-4124035
Fax:+ 1-770-2293323
Sergio Ferrante
First name:Sergio
Last name:Ferrante
Title:Researcher
Institution:Institute of Plant Genetics (Research Division of Palermo)
Address:CNR—Institute of Plant Genetics (Research Division of Palermo), Corso Calatafimi 414, 90129 Palermo, Italy
Country:Italy
Email:sergiopietro.ferrante@igv.cnr.it
Behrouz Golein
First name:Behrouz
Last name:Golein
Title:Researcher
Institution:Iran Citrus Research Institute
Address:Department of Plant Breeding and Improvement, Iran Citrus Research Institute, Ramsar, Islamic Republic of Iran
Country:Iran
Email:bgoleincitrus@yahhoo.com
Phone:+98 9113945261
Fax:+98 1925223282
Osman Gulsen
First name:Osman
Last name:Gulsen
Title:Researcher
Institution:Erciyes University, Turkey
Address:Erciyes University, Faculty of Agriculture, Department of Horticulture, 38039 Melikgazi, Kayseri, Turkey
Country:Turkey
Email:o_gulsen@yahoo.com
Phone:+90 352 4374901
Fax:+90 352 4376902
MJ Asins
First name:MJ
Last name:Asins
Title:Researcher
Institution:IVIA
Address:Instituto Valenciano de Investigaciones Agrarias (IVIA), Apartado Oficial, 46113 Moncada (Valencia), Spain
Country:Spain
Email:mjasins@ivia.es
Fax:+34-961390240
Qi-bin Hong
First name:Qi-Bin
Last name:Hong
Title:Researcher
Institution:Chinese Academy of Agricultural Sciences/Southwest University
Address:Citrus Research Institute, Chinese Academy of Agricultural Sciences/Southwest University, National Citrus Engineering Research Center, Chongqing, P.R. China
Country:China
Email:hongqb@sina.com
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerGT03.Forward PrimerCitrus spp.primer
Reverse PrimerGT03.Reverse PrimerCitrus spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SSRGT03.149SSRGT03.149Citrus spp.marker_locus
GT03, 180GT03, 180Citrus spp.marker_locus
GT03GT03Citrus spp.marker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Citrus-Orlando/Clementine-F1-Orlando-2010Orl-9N/A16SSRGT03.149View
2Citrus-Cleopatra/Trifoliatesp-F2-2012RPr4aN/A25GT03, 180View
3Citrus-Li2/Wan2-F1-2015LG7N/A2.6GT03View