Malic enzyme, Malic enzyme (genetic_marker) Citrus spp. | Citrus Genome Database

Marker Overview

Marker Overview


Name	Malic enzyme
Genbank ID	CB417399
Type	SSR
Species	Citrus spp.
Primer 1	Malic enzyme.Forward Primer: ACATGACGACATGCTTCTGG
Primer 2	Malic enzyme.Reverse Primer: CGTAGCCACGCCTAGTTCAT
Product Length	420
Publication	[view all]
Contact	Luis Navarro

Contact

Name

Details

Luis Navarro

First name:	Luis
Last name:	Navarro
Title:	Researcher
Institution:	IVIA
Address:	Centro de Proteccion Vegetal y Biotecnologıa, Instituto Valenciano de Investigaciones Agrarias (IVIA), 46113 Moncada, Valencia, Spain
Country:	Spain
Email:	lnavarro@ivia.es

Publications


Year	Publication
2012	García-Lor A, Luro F, Navarro L, Ollitrault P. Comparative use of InDel and SSR markers in deciphering the interspecific structure of cultivated citrus genetic diversity: a perspective for genetic association studies. Molecular genetics and genomics. 2012; 287(1):77-94.