|
Marker Overview
Name | mCrCIR07D05 |
Genbank ID | FR677574 |
Type | VNTR |
Species | Citrus spp. |
Primer 1 | mCrCIR07D05.Forward Primer: TCGTTCTTGCTTTTCCAC |
Primer 2 | mCrCIR07D05.Reverse Primer: GAATCAAACTACCCTCCAAT |
Max Length | 208 |
Publication | [view all] |
Contact | Patrick Ollitrault
|
Publications
Year | Publication |
2011 | Cuenca J, Froelicher Y, Aleza P, Juarez J, Navarro L, Ollitrault P. Multilocus half-tetrad analysis and centromere mapping in citrus: evidence of SDR mechanism for 2n megagametophyte production and partial chiasma interference in mandarin cv 'Fortune'. 2011. Heredity 107(5):462-470. |
2012 | Ollitrault, P, Terol, J, Chen, C, Federici, CT, Lotfy, S, Hippolyte, I, Ollitrault, F, Bérard, A, Chauveau, A, Cuenca, J, Costantino, G, Kacar, Y, Mu, L, Garcia-Lor, A, Froelicher, Y, Aleza, P, Boland, A, Billot, C, Navarro, L, Luro, F, Roose, ML, Gmitter, FG, Talon, M, and Brunel, D. A reference genetic map of C. clementina hort. ex Tan.; citrus evolution inferences from comparative mapping. BMC Genomics. 2012. 13:593. |
|