|
Marker Overview
Name | SCT08 |
Genbank ID | N/A |
Type | SCAR |
Species | Citrus spp. |
Primer 1 | SCT08.Forward Primer: AACGGCGACATATAATAACGA |
Primer 2 | SCT08.Reverse Primer: AACGGCGACAGTCTTGGGAAT |
Product Length | 605 |
Publication | [view all] |
Contact | Fred Gmitter
|
Publications
Year | Publication |
1997 | Deng Z, Huang S, Xiao S, Gmitter FJ. Development and characterization of SCAR markers linked to the citrus tristeza virus resistance gene from Poncirus trifoliata. Genome. 1997 Oct; 40(5):697-704. |
2001 | Deng Z, Huang S, Ling P, Yu C, Tao Q, Chen C, Wendell M, Zhang H, Gmitter FJ. Fine genetic mapping and BAC contig development for the citrus tristeza virus resistance gene locus in Poncirus trifoliata (Raf.). Molecular genetics and genomics : MGG. 2001 June; 265(4):739-747. |
|