Ci07D06, Ci07D06 (genetic_marker) Citrus spp.

Marker Overview
NameCi07D06
Genbank IDN/A
Typegenetic marker
SpeciesCitrus spp.
Primer 1Ci07D06.Forward Primer: CCTTTTCACAGTTTGCTAT
Primer 2Ci07D06.Reverse Primer: TCAATTCCTCTAGTGTGTGT
Publication[view all]
ContactYann Froelicher
Contact
NameDetails
Yann Froelicher
First name:Yann
Last name:Froelicher
Title:Researcher
Institution:CIRAD
Address:Cirad, UPR Multiplication vegetative, San Giuliano, F-20230 San Nicolao, France
Country:France
Email:froelicher@cirad.fr
Phone:+33 (0)495595937
Fax:+33 (0)495595937
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerCi07D06.Forward PrimerCitrus spp.primer
Reverse PrimerCi07D06.Reverse PrimerCitrus spp.primer