CiFT, CiFT (genetic_marker) Citrus spp.

Marker Overview
NameCiFT
Genbank IDAB027456
Typegene marker
SpeciesCitrus spp.
Primer 1CiFT.Forward Primer: AAAGCTGGCCCCTGTGGTTGC
Publication[view all]
ContactTomoko Endo
Fumie Nishikawa
Contact
NameDetails
Tomoko Endo
First name:Tomoko
Last name:Endo
Title:Researcher
Institution:Shizuoka University
Address:Faculty of Agriculture, Shizuoka University, Sizuoka, Shizuoka 422-8529, Japan
Country:Japan
Email:tomoen@affrc.go.jp
Last update:May 2020
Fumie Nishikawa
First name:Fumie
Last name:Nishikawa
Title:Researcher
Institution:National Agricultural Research Organization
Address:Okitsu Citrus Research Station, National Institute of Fruit Tree Science, National Agricultural Research Organization, 424-0292 Okitsu Shimizu-ku, Shizuoka, Japan
Country:Japan
Email:fumien@affrc.go.jp
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerCiFT.Forward PrimerCitrus spp.primer