|
|
Marker Overview
| Name | Dxs |
|---|
| Genbank ID | DN959423 |
|---|
| Type | PCR marker |
|---|
| Species | Citrus spp. |
|---|
| Primer 1 | Dxs.Forward Primer: CGTGTTTTCAACACACCTGACG |
|---|
| Primer 2 | Dxs.Reverse Primer: AAGCCCCGAAGTCTTCCTCAT |
|---|
| Product Length | 120 |
|---|
| Publication | [view all] |
|---|
| Contact | Patrick Ollitrault
|
|---|
Publications
| Year | Publication |
|---|
| 2009 | Bassene JB, Froelicher Y, Dhuique-Mayer C, Mouhaya W, Ferrer RM, Ancillo G, Morillon R, Navarro L, Ollitrault P. Non-additive phenotypic and transcriptomic inheritance in a citrus allotetraploid somatic hybrid between C. reticulata and C. limon: the case of pulp carotenoid biosynthesis pathway. Plant cell reports. 2009; 28(11):1689-1697. |
| 2013 | Garcia-Lor A, Curk F, Snoussi-Trifa H, Morillon R, Ancillo G, Luro F, Navarro L, Ollitrault P. A nuclear phylogenetic analysis: SNPs, indels and SSRs deliver new insights into the relationships in the 'true citrus fruit trees' group (Citrinae, Rutaceae) and the origin of cultivated species. Annals of botany. 2013 Jan; 111(1):1-19. |
| 2012 | Ollitrault, P, Terol, J, Chen, C, Federici, CT, Lotfy, S, Hippolyte, I, Ollitrault, F, Bérard, A, Chauveau, A, Cuenca, J, Costantino, G, Kacar, Y, Mu, L, Garcia-Lor, A, Froelicher, Y, Aleza, P, Boland, A, Billot, C, Navarro, L, Luro, F, Roose, ML, Gmitter, FG, Talon, M, and Brunel, D. A reference genetic map of C. clementina hort. ex Tan.; citrus evolution inferences from comparative mapping. BMC Genomics. 2012. 13:593. |
|
