ACO.1, ACO.1 (genetic_marker) Citrus spp.

Marker Overview
NameACO.1
AliasAconitase
Genbank IDAF073507
TypePCR Primer
SpeciesCitrus spp.
Primer 1ACO.1.Forward Primer: AAGATGGCCAGTGGATTGATG
Primer 2ACO.1.Reverse Primer: TCACCGAGGTTGACAACAATG
Publication[view all]
ContactJacqueline Burns
Patrick Ollitrault
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Reverse PrimerACO.1.Reverse PrimerCitrus spp.primer
Forward PrimerACO.1.Forward PrimerCitrus spp.primer


Contact
NameDetails
Jacqueline Burns
First name:Jacqueline
Last name:Burns
Title:Researcher
Institution:University of Florida
Address:University of Florida, IFAS, Horticultural Sciences Department, Citrus Research and Education Center, 700 Experiment Station Road, Lake Alfred, FL 33850, USA
Country:USA
Email:jkbu@ufl.edu
Phone:+1 863 9561151 x 1285
Fax:1 863 956 3579
Patrick Ollitrault
First name:Patrick
Last name:Ollitrault
Title:Researcher
Institution:CIRAD
Address:Unite de Recherche Multiplication Vegetative, Centre de Cooperation Internationale en Recherche Agronomique pour le Developpement (CIRAD), Montpellier 34398, France
Country:France
Email:patrick.ollitrault@cirad.fr
Phone:+33(0)467615971
Fax:+33(0)467615666