ERS1-partial, ERS1-partial (genetic_marker) Citrus spp.

Marker Overview
NameERS1-partial
Genbank IDN/A
TypePCR Primer
SpeciesCitrus spp.
Primer 1ERS1-partial.Forward Primer: TTGTGGACTGACTCACTTCATAAGC
Primer 2ERS1-partial.Reverse Primer: ATGACACAAAAGCACAAGCC
Publication[view all]
ContactJacqueline Burns
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Reverse PrimerERS1-partial.Reverse PrimerCitrus spp.primer
Forward PrimerERS1-partial.Forward PrimerCitrus spp.primer


Contact
NameDetails
Jacqueline Burns
First name:Jacqueline
Last name:Burns
Title:Researcher
Institution:University of Florida
Address:University of Florida, IFAS, Horticultural Sciences Department, Citrus Research and Education Center, 700 Experiment Station Road, Lake Alfred, FL 33850, USA
Country:USA
Email:jkbu@ufl.edu
Phone:+1 863 9561151 x 1285
Fax:1 863 956 3579