ETR1-partial, ETR1-partial (genetic_marker) Citrus spp.

Marker Overview
Genbank IDN/A
TypePCR Primer
SpeciesCitrus spp.
Primer 1ETR1-partial.Forward Primer: TCGTCAGCAGAATCCTGTTGG
Primer 2ETR1-partial.Reverse Primer: GGCCTTAATCTTGCTACTGGACA
Publication[view all]
ContactJacqueline Burns

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Reverse PrimerETR1-partial.Reverse PrimerCitrus spp.primer
Forward PrimerETR1-partial.Forward PrimerCitrus spp.primer

Jacqueline Burns
First name:Jacqueline
Last name:Burns
Institution:University of Florida
Address:University of Florida, IFAS, Horticultural Sciences Department, Citrus Research and Education Center, 700 Experiment Station Road, Lake Alfred, FL 33850, USA
Phone:+1 863 9561151 x 1285
Fax:1 863 956 3579