ETR3-full, ETR3-full (genetic_marker) Citrus spp.

Marker Overview
NameETR3-full
Genbank IDN/A
TypePCR Primer
SpeciesCitrus spp.
Primer 1ETR3-full.Forward Primer: ATGTTAAAAGCTTTAACCC
Primer 2ETR3-full.Reverse Primer: TCATACCCTTTCACCTACTTGTTGC
Publication[view all]
ContactJacqueline Burns
Commentfull length sequence
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Reverse PrimerETR3-full.Reverse PrimerCitrus spp.primer
Forward PrimerETR3-full.Forward PrimerCitrus spp.primer


Contact
NameDetails
Jacqueline Burns
First name:Jacqueline
Last name:Burns
Title:Researcher
Institution:University of Florida
Address:University of Florida, IFAS, Horticultural Sciences Department, Citrus Research and Education Center, 700 Experiment Station Road, Lake Alfred, FL 33850, USA
Country:USA
Email:jkbu@ufl.edu
Phone:+1 863 9561151 x 1285
Fax:1 863 956 3579