CAGG9, CAGG9 (genetic_marker) Citrus spp.

Marker Overview
NameCAGG9
Genbank IDN/A
TypeSSR
SpeciesCitrus spp.
Repeat MotifCAGG
Primer 1CAGG9.Forward: AATGCTGAAGATAATCCGCG
Primer 2CAGG9.Reverse: TGCCTTGCTCTCCACTCC
Publication[view all]
ContactA. Nematollahi
M Thomas
Maria-Teresa Scarano
Contact
NameDetails
A. Nematollahi
First name:A.
Last name:Nematollahi
Title:Researcher
Institution:College of Abouraihan
Address:Department of Horticulture, College of Abouraihan, University of Tehran, Tehran, Iran
Country:Iran
M Thomas
First name:M
Last name:Thomas
Institution:CSIRO
Address:CSIRO, Division of Horticulture, GPO Box 350, Adelaide, S.A 5001, Australia
Maria-Teresa Scarano
First name:Maria-Teresa
Last name:Scarano
Institution:Istituto di Genetica Vegetale-C.N.R.
Country:Italy
Email:mariateresa.scarano@igv.cnr.it
Last update:Feb 2003
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
ForwardCAGG9.ForwardCitrus spp.primer
ReverseCAGG9.ReverseCitrus spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CAGG9CAGG9Citrus spp.marker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Citrus-Sacaton/Troyer-RIL-1997LN/A49CAGG9View