CuSEP3, CuSEP3 (genetic_marker) Citrus spp.

Marker Overview
NameCuSEP3
Genbank IDAB218611
TypePCR marker
SpeciesCitrus spp.
Primer 1CuSEP3.Forward Primer: GCAGGCCCGAGTCTGAATAA
Primer 2CuSEP3.Reverse Primer: TGCCCGCCGCTCTCT
Publication[view all]
ContactFumie Nishikawa
Contact
NameDetails
Fumie Nishikawa
First name:Fumie
Last name:Nishikawa
Title:Researcher
Institution:National Agricultural Research Organization
Address:Okitsu Citrus Research Station, National Institute of Fruit Tree Science, National Agricultural Research Organization, 424-0292 Okitsu Shimizu-ku, Shizuoka, Japan
Country:Japan
Email:fumien@affrc.go.jp
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerCuSEP3.Forward PrimerCitrus spp.primer
Reverse PrimerCuSEP3.Reverse PrimerCitrus spp.primer