CCSM 03, CCSM 03 (genetic_marker) Citrus spp.

Marker Overview
NameCCSM 03
Genbank IDN/A
Typegenetic marker
SpeciesCitrus spp.
Repeat Motif(AG)17
Primer 1CCSM 03.Forward Primer: gcaatgcaccttgtcattag
Primer 2CCSM 03.Reverse Primer: catcacaggcacttatgcag
Product Length254
Publication[view all]
ContactValdenice Novelli
Contact
NameDetails
Valdenice Novelli
First name:Valdenice
Last name:Novelli
Title:Researcher
Institution:Centro APTA Citros “Sylvio Moreira
Address:Centro APTA Citros “Sylvio Moreira”, IAC, Rodovia Anhanguera Km 158 C.P. 04, C.E.P. 13490-970 Cordeiropolis, Sao Paulo, Brazil
Country:Brazil
Email:valdenice@centrodecitricultura.br
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerCCSM 03.Forward PrimerCitrus spp.primer
Reverse PrimerCCSM 03.Reverse PrimerCitrus spp.primer