CCSM 17, CCSM 17 (genetic_marker) Citrus spp.

Marker Overview
NameCCSM 17
Genbank IDN/A
Typegenetic marker
SpeciesCitrus spp.
Repeat Motif(AG)21
Primer 1CCSM 17.Forward Primer: acatggacaggacaactaag
Primer 2CCSM 17.Reverse Primer: gttatgatacgtctgtgtcc
Max Length100
Publication[view all]
ContactValdenice Novelli
Contact
NameDetails
Valdenice Novelli
First name:Valdenice
Last name:Novelli
Title:Researcher
Institution:Centro APTA Citros “Sylvio Moreira
Address:Centro APTA Citros “Sylvio Moreira”, IAC, Rodovia Anhanguera Km 158 C.P. 04, C.E.P. 13490-970 Cordeiropolis, Sao Paulo, Brazil
Country:Brazil
Email:valdenice@centrodecitricultura.br
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerCCSM 17.Forward PrimerCitrus spp.primer
Reverse PrimerCCSM 17.Reverse PrimerCitrus spp.primer