CCSM17, CCSM17 (genetic_marker) Citrus spp.

Marker Overview
NameCCSM17
Genbank IDN/A
TypeSSR
SpeciesCitrus spp.
Primer 1CCSM17.Forward Primer: ACATGGACAGGACAACTAAG
Primer 2CCSM17.Reverse Primer: GTTATGATACGTCTGTGTCC
Publication[view all]
ContactBehrouz Golein
Qi-bin Hong
Contact
NameDetails
Behrouz Golein
First name:Behrouz
Last name:Golein
Title:Researcher
Institution:Iran Citrus Research Institute
Address:Department of Plant Breeding and Improvement, Iran Citrus Research Institute, Ramsar, Islamic Republic of Iran
Country:Iran
Email:bgoleincitrus@yahhoo.com
Phone:+98 9113945261
Fax:+98 1925223282
Qi-bin Hong
First name:Qi-Bin
Last name:Hong
Title:Researcher
Institution:Chinese Academy of Agricultural Sciences/Southwest University
Address:Citrus Research Institute, Chinese Academy of Agricultural Sciences/Southwest University, National Citrus Engineering Research Center, Chongqing, P.R. China
Country:China
Email:hongqb@sina.com
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerCCSM17.Forward PrimerCitrus spp.primer
Reverse PrimerCCSM17.Reverse PrimerCitrus spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CCSM17CCSM17Citrus spp.marker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Citrus-Li2/Wan2-F1-2015LG3N/A84.3CCSM17View