ORF106, ORF106 (genetic_marker) Citrus spp.

Marker Overview
NameORF106
Genbank IDN/A
TypePCR-RFLP
SpeciesCitrus spp.
Primer 1ORF106.Forward Primer: ACTACAGATCTCATACTACCCC
Publication[view all]
ContactBehrouz Golein
Contact
NameDetails
Behrouz Golein
First name:Behrouz
Last name:Golein
Title:Researcher
Institution:Iran Citrus Research Institute
Address:Department of Plant Breeding and Improvement, Iran Citrus Research Institute, Ramsar, Islamic Republic of Iran
Country:Iran
Email:bgoleincitrus@yahhoo.com
Phone:+98 9113945261
Fax:+98 1925223282
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerORF106.Forward PrimerCitrus spp.primer