SOS1, SOS1 (genetic_marker) Citrus spp.

Marker Overview
NameSOS1
Genbank IDDN959478
TypeGene marker
SpeciesCitrus spp.
Primer 1SOS1.Forward Primer: ACCAGTCAGACAACCATTTG
Primer 2SOS1.Reverse Primer: CCAATTAGCACCTCATAGAGAC
Publication[view all]
ContactPatrick Ollitrault
MJ Asins
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerSOS1.Forward PrimerCitrus spp.primer
Reverse PrimerSOS1.Reverse PrimerCitrus spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SOS1, 500SOS1, 500Citrus spp.marker_locus
SOS1,500SOS1,500Citrus spp.marker_locus


Contact
NameDetails
Patrick Ollitrault
First name:Patrick
Last name:Ollitrault
Title:Researcher
Institution:CIRAD
Address:Unite de Recherche Multiplication Vegetative, Centre de Cooperation Internationale en Recherche Agronomique pour le Developpement (CIRAD), Montpellier 34398, France
Country:France
Email:patrick.ollitrault@cirad.fr
Phone:+33(0)467615971
Fax:+33(0)467615666
MJ Asins
First name:MJ
Last name:Asins
Title:Researcher
Institution:IVIA
Address:Instituto Valenciano de Investigaciones Agrarias (IVIA), Apartado Oficial, 46113 Moncada (Valencia), Spain
Country:Spain
Email:mjasins@ivia.es
Fax:+34-961390240
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Poncirus-Rich/FlyingDragon-F1-2012Pr10+5bN/A77SOS1, 500View
2Poncirus-FlyingDragon/FlyingDragon-F2-2000Prf10+5bN/A14SOS1, 500View
3Poncirus-Rich/Rich-F2-2000Prr10+5b(b)N/A0SOS1, 500View
4Citrus-Cleopatra/P.trifoliata-P.trifoliata-F1-2016p10+5bN/A98.27SOS1,500View