sinensis_213830_contig11033_p290_TC, sinensis_213830_contig11033_p290_TC (genetic_marker) Citrus spp.

Marker Overview
SNP AllelesN/A
SpeciesCitrus spp.
Primer 1sinensis_213830_contig11033_p290_TC.Forward Primer: AAGAGTGTGTTGCGGTCTGA
Primer 2sinensis_213830_contig11033_p290_TC.Reverse Primer: TCTGCGATTGCTTTTGTTTG
Primer 3sinensis_213830_contig11033_p290_TC.SBE Primer: GAACCCAGCAATTTTGAGC
Publication[view all]
ContactChunxian Chen
Chunxian Chen
First name:Chunxian
Last name:Chen
Address:University of Florida, IFAS, Citrus Research and Education Center,700 Experiment Station Road, Lake Alfred, FL 33850, USA

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward Primersinensis_213830_contig11033_p290_TC.Forward PrimerCitrus spp.primer
Reverse Primersinensis_213830_contig11033_p290_TC.Reverse PrimerCitrus spp.primer
SBE Primersinensis_213830_contig11033_p290_TC.SBE PrimerCitrus spp.primer

>sinensis_213830_contig11033_p290_TC ID=sinensis_213830_contig11033_p290_TC|Name=sinensis_213830_contig11033_p290_TC|organism=Citrus spp.|type=genetic_marker|length=25bp