sinensis_213830_contig13549_p695_A-, sinensis_213830_contig13549_p695_A- (genetic_marker) Citrus spp.

Marker Overview
Namesinensis_213830_contig13549_p695_A-
dbSNP IDN/A
TypeSNP
SNP AllelesN/A
SpeciesCitrus spp.
Primer 1sinensis_213830_contig13549_p695_A-.Forward Primer: CAAGAGCATGCTGGAAATGA
Primer 2sinensis_213830_contig13549_p695_A-.Reverse Primer: CACCTCCTCCTCCTCCTTCT
Primer 3sinensis_213830_contig13549_p695_A-.SBE Primer: GAAGTTGCTGAATCCCAAAAAA
Publication[view all]
ContactChunxian Chen
Contact
NameDetails
Chunxian Chen
First name:Chunxian
Last name:Chen
Title:Researcher
Institution:UFL
Address:University of Florida, IFAS, Citrus Research and Education Center,700 Experiment Station Road, Lake Alfred, FL 33850, USA
Country:USA
Email:cxchen@crec.ifas.ufl.edu
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward Primersinensis_213830_contig13549_p695_A-.Forward PrimerCitrus spp.primer
Reverse Primersinensis_213830_contig13549_p695_A-.Reverse PrimerCitrus spp.primer
SBE Primersinensis_213830_contig13549_p695_A-.SBE PrimerCitrus spp.primer


Sequence
>sinensis_213830_contig13549_p695_A- ID=sinensis_213830_contig13549_p695_A-|Name=sinensis_213830_contig13549_p695_A-|organism=Citrus spp.|type=genetic_marker|length=25bp
AATCCCAAAAAAAGAAAGAGGAGAA