CCSM18.1, CCSM18.1 (genetic_marker) Citrus sinensis

Marker Overview
NameCCSM18.1
Genbank IDN/A
TypeSSR
SpeciesCitrus sinensis
Repeat Motif(AG)n
Primer 1CCSM18.1.Forward Primer: aacagttgatgaagaggaag
Primer 2CCSM18.1.Reverse Primer: gtgattgctggtgtcgtt
Product Length150; 280; 300; 380
Publication[view all]
ContactValdenice Novelli
Contact
NameDetails
Valdenice Novelli
First name:Valdenice
Last name:Novelli
Title:Researcher
Institution:Centro APTA Citros “Sylvio Moreira
Address:Centro APTA Citros “Sylvio Moreira”, IAC, Rodovia Anhanguera Km 158 C.P. 04, C.E.P. 13490-970 Cordeiropolis, Sao Paulo, Brazil
Country:Brazil
Email:valdenice@centrodecitricultura.br
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerCCSM18.1.Forward PrimerCitrus sinensisprimer
Reverse PrimerCCSM18.1.Reverse PrimerCitrus sinensisprimer