Csin.0018, Csin.0018 (genetic_marker) Citrus sinensis

Marker Overview
Genbank IDN/A
SpeciesCitrus sinensis
Primer 1Csin.0018.Forward Primer: TCAATTTTGCATCCTTGTGG
Primer 2Csin.0018.Reverse Primer: TCCCTCTAGCAATCATAGTCCA
Publication[view all]
ContactX.X. Deng

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Reverse PrimerCsin.0018.Reverse PrimerCitrus sinensisprimer
Forward PrimerCsin.0018.Forward PrimerCitrus sinensisprimer

X.X. Deng
First name:X.X.
Last name:Deng
Institution:Huazhong Agricultural University
Address:National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan 430070, P.R. China