Csin.0056, Csin.0056 (genetic_marker) Citrus sinensis

Marker Overview
NameCsin.0056
Genbank IDN/A
TypeSSR
SpeciesCitrus sinensis
Primer 1Csin.0056.Forward Primer: TTCTGGTATAACAACGCCAATG
Primer 2Csin.0056.Reverse Primer: TCGGAATCAGAATGAGCAGA
Publication[view all]
ContactX.X. Deng
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Reverse PrimerCsin.0056.Reverse PrimerCitrus sinensisprimer
Forward PrimerCsin.0056.Forward PrimerCitrus sinensisprimer


Contact
NameDetails
X.X. Deng
First name:X.X.
Last name:Deng
Title:Researcher
Institution:Huazhong Agricultural University
Address:National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan 430070, P.R. China
Country:China
Email:dxxwwlj@public.wh.hb.cn