|
Marker Overview
Name | Af1031 |
Genbank ID | CX071365 |
Type | CAPS |
Species | Citrus spp. |
Primer 1 | Af1031.Forward Primer: CAACACTAAACTTGGGTCATA |
Primer 2 | Af1031.Reverse Primer: CTTCCTATCATAATCGC |
Product Length | 1000 |
Restriction Enzyme | Hinc2 |
Publication | [view all] |
Contact | S. Ohta Mitsuo Omura
|
Publications
Year | Publication |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2014 | Shimada T, Fujii H, Endo T, Ueda T, Sugiyama A, Nakano M, Kita M, Yoshioka T, Shimizu T, Nesumi H, Ikoma Y, Moriguchi T, Omura M. Construction of a citrus framework genetic map anchored by 708 gene-based markers. Tree genetics & genomes. 2014; 10(4):1001-1013. |
2016 | García-Flores LA, Medina S, Cejuela-Anta R, Martínez-Sanz JM, Abellán Á, Genieser HG, Ferreres F, Gil-Izquierdo Á. DNA catabolites in triathletes: effects of supplementation with an aronia-citrus juice (polyphenols-rich juice). Food & function. 2016 Apr 6. |
|