Af1036, Af1036 (genetic_marker) Citrus spp.

Marker Overview
NameAf1036
Genbank IDforward primer
TypeCAPS
SpeciesCitrus spp.
Primer 1Af1036.Forward Primer: CGAGCAGCAGCGCCTAC
Primer 2Af1036.Reverse Primer: GCGGCTAAGTATCTCTTCGTC
Product Length1300
Restriction EnzymeHinf1;Hha1
Publication[view all]
ContactMitsuo Omura
Contact
NameDetails
Mitsuo Omura
First name:Mitsuo
Last name:Omura
Title:Researcher
Institution:NARO Institute of Fruit Tree Science
Address:Department of Citrus Research, NARO Institute of Fruit Tree Science, National Agricultural Research Organization, 485-6 Okitsu-Nakacho Shimizu-ku, Shizuoka 424-0292, Japan
Country:Japan
Email:amomura@ipc.shizuoka.ac.jp
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerAf1036.Forward PrimerCitrus spp.primer
Reverse PrimerAf1036.Reverse PrimerCitrus spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Af1036afAf1036afCitrus spp.marker_locus
Af1036Af1036Citrus spp.marker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Citrus-Okitsu-46-gou/Kankitsu-Chukanbohon-Nou-5-gou-F2-2014AGI-05N/A43.1Af1036afView
2Citrus-Hyuganatsu/2-11-BC1LG03N/A42.2Af1036View